ID: 1199853563

View in Genome Browser
Species Human (GRCh38)
Location X:151741839-151741861
Sequence CAGTCTCAGTGGGAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 1, 2: 11, 3: 39, 4: 457}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199853555_1199853563 2 Left 1199853555 X:151741814-151741836 CCATCACTGGCATGGGCCAGCTC 0: 1
1: 0
2: 3
3: 21
4: 188
Right 1199853563 X:151741839-151741861 CAGTCTCAGTGGGAAGGGGAGGG 0: 1
1: 1
2: 11
3: 39
4: 457
1199853551_1199853563 30 Left 1199853551 X:151741786-151741808 CCTAGTGTGGCTGGAGGCTGTGA 0: 1
1: 0
2: 4
3: 33
4: 293
Right 1199853563 X:151741839-151741861 CAGTCTCAGTGGGAAGGGGAGGG 0: 1
1: 1
2: 11
3: 39
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199853563 Original CRISPR CAGTCTCAGTGGGAAGGGGA GGG Intronic
900081650 1:863029-863051 CAATCTCAGAGGCCAGGGGATGG + Intergenic
900253181 1:1682452-1682474 CAGTCCCAGTGTCAAAGGGACGG + Intronic
900280366 1:1863418-1863440 CAGCCACAGTGGGCAAGGGACGG - Intronic
900373931 1:2344695-2344717 CCGCCCCAGTGGGAAGGGAAAGG + Intronic
902561194 1:17278646-17278668 CAGTCTCAGTGGGGCTGGAAAGG - Intronic
902570262 1:17342495-17342517 AGCTCTCAGTGGGCAGGGGAGGG - Intronic
902773139 1:18657776-18657798 CATTCTCAATAAGAAGGGGAAGG - Intronic
903110367 1:21127912-21127934 AAGTTTCAGTGGGCAGGGCACGG + Intronic
903266796 1:22162712-22162734 CAGTGTCCGCAGGAAGGGGATGG + Intergenic
904092670 1:27956166-27956188 GAGGCTCAGTGGTCAGGGGAAGG - Intronic
904131805 1:28281057-28281079 CTGCCTCTGTGGGCAGGGGAAGG - Exonic
905215941 1:36407686-36407708 CAGTTGCAGTGGGAATGGAAAGG + Intergenic
905348185 1:37326060-37326082 CACTCTCAGGGGGAGAGGGAAGG + Intergenic
906075090 1:43046317-43046339 CAGTCACAGTGGGACAGGGGAGG - Intergenic
906702064 1:47866769-47866791 CAGGCCCAGTGGGATGGAGAGGG - Intronic
907373997 1:54020763-54020785 CAGTCTCACTCTCAAGGGGAGGG + Intergenic
908173037 1:61526859-61526881 GAGTCCCAGAGGGTAGGGGAAGG - Intergenic
909115503 1:71529801-71529823 CAGTCTCAGTTTGAAAGGTAAGG - Intronic
910120342 1:83781675-83781697 CAGGCAAAGAGGGAAGGGGAAGG + Intergenic
911440669 1:97921511-97921533 CAGCCCCAGCGGGGAGGGGAGGG + Intergenic
912469083 1:109894318-109894340 CAGTCAGAGTGGGAAGAGAAGGG - Intergenic
912596295 1:110880243-110880265 CAGTAACAGTGAAAAGGGGAAGG + Intronic
913452466 1:119001384-119001406 CAGGCTGAGGGGGCAGGGGAGGG + Intergenic
913592614 1:120342706-120342728 CAGGCACTGAGGGAAGGGGAGGG - Intergenic
913650739 1:120912424-120912446 CAGGCACTGAGGGAAGGGGAGGG + Intergenic
914170375 1:145216643-145216665 CAGGCACTGAGGGAAGGGGAGGG - Intergenic
914525491 1:148460609-148460631 CAGGCACTGAGGGAAGGGGAGGG - Intergenic
914598182 1:149175220-149175242 CAGGCACTGAGGGAAGGGGAGGG + Intergenic
914640909 1:149606519-149606541 CAGGCACTGAGGGAAGGGGAGGG + Intergenic
914707068 1:150179150-150179172 CAGAGGCAGTGGGAAGGGGGTGG - Intergenic
914854478 1:151341257-151341279 TAGTCTCAGAAGGAAGGAGAGGG - Exonic
915063307 1:153204399-153204421 CAGTTTCAGTGGGGTGGGGGAGG + Intronic
915521651 1:156448694-156448716 CAGCCTCAGGCGGAAGGGCAGGG + Intergenic
915726035 1:158018337-158018359 CAGAGTCAGGGGGCAGGGGAAGG + Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
916590932 1:166189489-166189511 CAGACTCAGTGGGTAAGGGAGGG - Intergenic
918528254 1:185488507-185488529 CAGTCTCAGTAGGGAGTGAAAGG - Intergenic
919365447 1:196655176-196655198 CAATTTCAGTGGGCGGGGGAGGG + Intronic
920349985 1:205331555-205331577 CAATCCCTGGGGGAAGGGGAAGG - Intergenic
920465057 1:206176285-206176307 CACCCTCAGTGGGATGGGGCAGG - Intergenic
922155300 1:223036339-223036361 GAGGCTGAGAGGGAAGGGGAGGG + Intergenic
922548728 1:226478211-226478233 CAGTAGCAGAGGGAATGGGATGG - Intergenic
923459639 1:234197204-234197226 CAGCCTCAGTGGGAGTGGGTAGG - Intronic
924372950 1:243373762-243373784 CACTCTCAGTGGAAGGGAGATGG + Intronic
924567582 1:245211330-245211352 CAGTCACAGCGGGCAGGGGATGG - Intronic
924633947 1:245767286-245767308 GAGTCTGAGTGAGAAGGTGAGGG + Intronic
924644907 1:245868784-245868806 CAGCCACAGTGGGATGGGTAGGG - Intronic
1063072362 10:2679742-2679764 CAGTCTTAGTGGGAGGGCGCTGG + Intergenic
1063265000 10:4438324-4438346 AAGCATCAGTGTGAAGGGGAAGG - Intergenic
1064625357 10:17255769-17255791 CAATCAGAGTGGAAAGGGGAAGG - Intergenic
1066157391 10:32692535-32692557 CACTCTCAGTGGAAGGGTGATGG - Intronic
1067767050 10:49094768-49094790 CATTCTCAGTGGCAGGGGGTGGG + Intronic
1068670473 10:59717274-59717296 GAGTATTTGTGGGAAGGGGAAGG + Intronic
1070148618 10:73792132-73792154 CTGGCTCAGTAGGAAGGGGTCGG - Exonic
1070298258 10:75183682-75183704 GCGTCTCAGTGGGAAGGTGTTGG + Intergenic
1070983073 10:80665834-80665856 CAGGGTTAGTGGGAAGGGGACGG + Intergenic
1070987405 10:80700671-80700693 CTCTCTCTCTGGGAAGGGGATGG - Intergenic
1071220505 10:83459615-83459637 CATTTTTAGTGGCAAGGGGAAGG - Intergenic
1071471734 10:85988305-85988327 CAGACTCTGTGTGAAGGGTAGGG - Intronic
1073251570 10:102123063-102123085 TAGTGTCAGTGGGAGTGGGAAGG - Intergenic
1073543157 10:104328469-104328491 CTTTCTCAGTGGGACAGGGAGGG + Intronic
1073543165 10:104328536-104328558 CTGACTCAATGGAAAGGGGAAGG + Intronic
1075343976 10:121668837-121668859 CAGTCCCAGTGGGAGGGAAAAGG - Intergenic
1075368395 10:121913709-121913731 CAGTCATCTTGGGAAGGGGAAGG - Intronic
1075713277 10:124542098-124542120 CAGGCACAGTGGGAAGGTCATGG - Intronic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1076225268 10:128769604-128769626 AAATGTCAGTGGGAAGGGGAGGG + Intergenic
1076428811 10:130387466-130387488 CAGACACAGAGGGAAGAGGAGGG + Intergenic
1076993218 11:286192-286214 CAGTCTGAGTGGGGAGGTGGGGG + Intergenic
1077578611 11:3402830-3402852 CAGTCTCAATGAGAAGGGGAGGG + Intergenic
1077696073 11:4393697-4393719 AAGTCTGAGAGGAAAGGGGAGGG + Intergenic
1078106466 11:8361199-8361221 CAGGGCCAGAGGGAAGGGGAGGG + Intergenic
1078186970 11:9060381-9060403 CAGTCTCCCTGGGGAGGTGAAGG + Intronic
1078747071 11:14125886-14125908 CAGTCTCAGTGTGAAGGCCTGGG + Intronic
1078964234 11:16319304-16319326 AAGTATCAGTGGTAAGGGTAAGG - Intronic
1079994087 11:27276903-27276925 CAGTCTAAATGGGAAAGGTAAGG - Intergenic
1080492484 11:32781456-32781478 CAGACTCTGTTGGCAGGGGAGGG - Intronic
1081822510 11:46013311-46013333 CAGTCTGGGTAGGAAGGGGTGGG - Intronic
1081952387 11:47055378-47055400 TAACCTCAGTGGGGAGGGGAGGG - Intronic
1082016845 11:47495560-47495582 ATGTCTCAATGTGAAGGGGAGGG + Intronic
1082287495 11:50333570-50333592 AAGTTTCGGGGGGAAGGGGAAGG - Intergenic
1083042599 11:59702107-59702129 CTGTCCGAGGGGGAAGGGGAGGG - Intergenic
1083312176 11:61789641-61789663 CAGACTCAGTGGAATGGGTAGGG - Intronic
1083330621 11:61896764-61896786 CAGTCACAGTTGGAAGAGGTGGG - Intergenic
1083724521 11:64621319-64621341 TGGTCTCAGTGGGAGGGTGATGG - Intronic
1084235647 11:67786343-67786365 CGGTCTCAATGAGAAGGGGAGGG + Intergenic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1086280943 11:85187822-85187844 CAGTCTCAGTGGCAAGCAAAAGG + Intronic
1086608361 11:88724705-88724727 CAGTCCCAGTGAGAAGAGCAAGG - Intronic
1086941618 11:92803979-92804001 GAGACTGAGTGGGAAGGGGTGGG - Intronic
1088919910 11:114253245-114253267 CAGGCTGAGTGGGAAGGGCATGG - Intergenic
1089006043 11:115091531-115091553 CAGTGGCAGTGGGAAGAGTAGGG + Intergenic
1089158666 11:116421511-116421533 CACTCTTGTTGGGAAGGGGAAGG + Intergenic
1089599834 11:119606577-119606599 AAGTCTCAGAGGGAGAGGGAGGG - Intergenic
1089701313 11:120245790-120245812 CTGGCTCAGTGAGAAAGGGATGG - Intronic
1089975622 11:122729214-122729236 AAGTCTCAGTGGGAACTGCAGGG - Intronic
1090007214 11:123013256-123013278 CACTCTCAGTGGAAAGGATAAGG + Intergenic
1090280700 11:125453744-125453766 CAGTCTTAGTGGGAATGGCTTGG + Intronic
1090423339 11:126590661-126590683 CAGCCTCAGTGGGAGAGTGATGG + Intronic
1090616720 11:128522068-128522090 TAGTAACAGGGGGAAGGGGACGG + Intronic
1091287092 11:134413406-134413428 CATCCTCAGTGGGAAGAGCAGGG - Intergenic
1091711730 12:2745823-2745845 CAGTGGCTGTGGGAAGGGAAGGG - Intergenic
1092040573 12:5380274-5380296 TAGTCACAGTGAAAAGGGGAGGG + Intergenic
1094426471 12:30321645-30321667 GAGTCCCAATGGGAAGAGGATGG - Intergenic
1094526758 12:31236239-31236261 CAGGTTCAGTCGGAGGGGGAGGG - Intergenic
1094760844 12:33530967-33530989 CAAACTCAGTGGAATGGGGAGGG + Intergenic
1095331169 12:40966417-40966439 GATTCTCAGTGGGAAGGGGAAGG - Intronic
1095554299 12:43482590-43482612 CAGCCCCAGTGGGAAGCAGAAGG - Intronic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1095786076 12:46110088-46110110 CAGTCCCAGTGGGGATAGGAGGG - Intergenic
1096757057 12:53808478-53808500 CCCTCTCAGTGGGATGAGGAAGG - Intergenic
1097769604 12:63567160-63567182 GAGGCTGAGTGGGAAGGGTAGGG - Intronic
1098225691 12:68320529-68320551 CAGCCTCTGGGGGAAGGGGCTGG - Intronic
1099777771 12:87155443-87155465 CAATTTCAGTTGGATGGGGAAGG - Intergenic
1099978541 12:89571649-89571671 CTGACTCAGAGGGAGGGGGAGGG + Intergenic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1101774286 12:107779508-107779530 CAGTATCATTGGGAATGTGAAGG + Intergenic
1102502123 12:113359811-113359833 CAGAGTCAGTGGGAGTGGGAAGG + Intronic
1102969388 12:117154270-117154292 CTGTCTCAGTGTGATGGGGATGG - Intronic
1103395250 12:120602061-120602083 CAGTCCCAGTGGGAAACAGATGG + Intergenic
1103528399 12:121582612-121582634 CTGTCAGAGTGGGAAGGGGCTGG + Intergenic
1105413886 13:20192980-20193002 CAGTCTCCGAGGGAAGAGGCGGG - Intergenic
1105833016 13:24182428-24182450 CAGTCACAGTGGGAGGTGAAGGG + Intronic
1106022519 13:25929117-25929139 CATCCTCAGTGGGAAGTGGTAGG - Intronic
1108284315 13:48891019-48891041 CACTCACAGTGGCAAGAGGAGGG + Intergenic
1108762187 13:53581377-53581399 CTGGCTCAGTGGGAAAGGGCTGG + Intergenic
1112002909 13:95228380-95228402 CAGACTGAGTAGGAAGTGGAAGG - Intronic
1112503249 13:99957786-99957808 CAGTCTCTGCAGGAAGGGTAGGG + Intergenic
1113853712 13:113432650-113432672 CAGACTCAGTGGGGGTGGGACGG + Intronic
1114515635 14:23298096-23298118 GAGTGTAAGTGGGAAGGTGAGGG + Exonic
1114826744 14:26090113-26090135 CAGCGGCAGTGGGCAGGGGATGG - Intergenic
1115813233 14:37133454-37133476 CAGTGGCAGTGGGAAAGAGAAGG - Intronic
1115892707 14:38049690-38049712 CAGGCTCAGAGGGAAGTGGTGGG + Intergenic
1115928865 14:38467878-38467900 TAGGCTCCCTGGGAAGGGGAAGG - Intergenic
1117609323 14:57465910-57465932 CAGTCTCAGAATGAAGGGCAGGG + Intergenic
1118639144 14:67776169-67776191 GATTCTCACTGGGAAGGGGAAGG + Intronic
1118944367 14:70370577-70370599 CAGGCTCAATTGGAAAGGGAAGG - Exonic
1119541578 14:75441924-75441946 CATTTTCAGTTGGGAGGGGAGGG + Intronic
1120861228 14:89256592-89256614 CTTGCTCAGTGGGAAGAGGAAGG - Intronic
1121351903 14:93180354-93180376 CAGGCTGAGGGGGAAAGGGAGGG - Intergenic
1121508363 14:94493473-94493495 CAGTCCCAGAGGGATGGGGGAGG + Intronic
1122762873 14:104042772-104042794 CAGTCTCCCTGGGAAGGGCCCGG + Intronic
1123449098 15:20349326-20349348 GAGTCCCAGGGGGAGGGGGAGGG - Intergenic
1123632601 15:22272554-22272576 CAGTCTCAGGGGGATGCGGTGGG + Intergenic
1124363098 15:29053327-29053349 CAGTTTGAGGGGGAAGAGGAGGG + Intronic
1124929055 15:34101488-34101510 CTGTCTCAGACTGAAGGGGAGGG - Intronic
1125339978 15:38665660-38665682 CAGTCAATGTGGGAAGGGGGAGG - Intergenic
1125483814 15:40098613-40098635 CAGTCCGTGTGTGAAGGGGAGGG - Intronic
1126578683 15:50222250-50222272 CTGTCCCAGTGGGATGGGGAGGG - Intronic
1128314673 15:66653161-66653183 CAGTGTCTGTGGGGAGGGGGAGG + Intronic
1128481914 15:68046683-68046705 CAGTCTCCCTCGGCAGGGGAGGG + Intergenic
1128737373 15:70060816-70060838 CAGTCTCAGGGGAGTGGGGAAGG - Intronic
1129055066 15:72813534-72813556 CAGTCACAGTGGTCAGAGGAAGG + Intergenic
1129111029 15:73337183-73337205 GAGTCACAGTGAGAATGGGAAGG - Intronic
1129359769 15:75017549-75017571 TAGTCTCATTGTCAAGGGGATGG - Intronic
1130297032 15:82654665-82654687 CAGCCTCTGTGGGAGGGGCAGGG - Intergenic
1130381896 15:83378924-83378946 TCATCTCACTGGGAAGGGGAGGG + Intergenic
1130859001 15:87869266-87869288 CAGAGTCAGTGGGGAGAGGAGGG + Intronic
1131716267 15:95113963-95113985 CAGCCACAGTGGAAAGAGGAGGG + Intergenic
1131766450 15:95681009-95681031 CAGTCACAGTGGAAGGGGAAGGG - Intergenic
1131864996 15:96698779-96698801 GAGTCTGAGTGGGAAGGAGGGGG + Intergenic
1131964339 15:97824393-97824415 CAGGGTCTGGGGGAAGGGGAAGG + Intergenic
1132714495 16:1284027-1284049 CAGATTCAGTGGGAAGAGGTGGG - Intergenic
1133020323 16:2964192-2964214 TAGGCTCAGTGGGAGGGGGCGGG + Exonic
1133347216 16:5078979-5079001 CGGTCTCAATGAGAACGGGAGGG + Intronic
1133654253 16:7844451-7844473 CAGTCTAAGTGGGAAAAAGAAGG + Intergenic
1134046946 16:11108074-11108096 CAGCCTCTGTGGGATGGAGACGG - Intronic
1134067891 16:11240955-11240977 GGTTCTCAGTGGGAAGGGGAGGG + Intergenic
1134137686 16:11690175-11690197 CAGCCTCATTGGAAACGGGAGGG - Intronic
1134761776 16:16720905-16720927 CATTCTCTGGGGGAAGGGGAGGG - Intergenic
1134862610 16:17574108-17574130 CAGTGTCAGTGAGAAGAGGGAGG + Intergenic
1134984282 16:18638265-18638287 CATTCTCTGGGGGAAGGGGAGGG + Intergenic
1137954522 16:52815494-52815516 CACACTCCTTGGGAAGGGGAGGG - Intergenic
1138560854 16:57800279-57800301 CAGTCTTACTGGGAAGGGGATGG + Intronic
1138592973 16:58012675-58012697 CACTCTCTGTGGAAGGGGGAAGG - Intronic
1139267988 16:65657512-65657534 CCTTCTCAGTGGGCAGGGGCTGG - Intergenic
1139372927 16:66479772-66479794 CAGTGGCAGTGGGAAGAGAAAGG + Intronic
1139504715 16:67393161-67393183 CTGTCCCAGTGGGAGCGGGACGG - Intronic
1139582408 16:67881248-67881270 TGGTCACTGTGGGAAGGGGAAGG - Exonic
1139630949 16:68231614-68231636 AGGTGCCAGTGGGAAGGGGATGG + Exonic
1140151058 16:72366273-72366295 CAATATCAGAGGGAATGGGAAGG - Intergenic
1141523689 16:84598166-84598188 CTCTCTGGGTGGGAAGGGGAGGG - Intronic
1142521491 17:507890-507912 CAGTGTCACTGGGATGGAGAAGG - Intergenic
1142982319 17:3679422-3679444 GAGCCTCTGTGGGAAGGGGCTGG - Intronic
1143041731 17:4043105-4043127 CAGGCTCAGGGAGATGGGGAGGG - Intronic
1143282338 17:5764344-5764366 CCTTCTCTTTGGGAAGGGGAGGG + Intergenic
1143322288 17:6075900-6075922 CAGTCCCAGTGGGCTGGGGCGGG + Intronic
1143583360 17:7838979-7839001 GAGTCTCTGAGGCAAGGGGAAGG + Intergenic
1144855898 17:18267651-18267673 CAGTCACAGCTGGAAGGGGTAGG - Intergenic
1147135038 17:38429327-38429349 CAGGCTCAGAGGTAAGGGAATGG - Intronic
1147149961 17:38509012-38509034 GAGTCTCAGTGGGGAAGGCAGGG + Intronic
1147515910 17:41117572-41117594 CAGAGTCAGTGGGATGGTGATGG + Exonic
1147741375 17:42672596-42672618 CAGGCTTAGTGGGATTGGGAAGG - Intronic
1148205122 17:45775185-45775207 CAGCCAGAGTGGGAAGGTGACGG + Intergenic
1148456658 17:47814795-47814817 CAGCCACCTTGGGAAGGGGAGGG + Intronic
1150011121 17:61505236-61505258 GAGAATCAGTGTGAAGGGGATGG + Intergenic
1150613013 17:66748899-66748921 CAGCTTCAGGAGGAAGGGGAGGG + Intronic
1150731279 17:67697405-67697427 CAGTGGCAGTGGTATGGGGATGG - Intergenic
1151159220 17:72150889-72150911 CACTCTTAATGGGAAGGAGAAGG - Intergenic
1151717402 17:75838123-75838145 GAGTCTGAGTGGGAGGCGGAGGG - Intronic
1151803219 17:76390005-76390027 CAGGCTCAATCCGAAGGGGACGG - Exonic
1152059779 17:78063381-78063403 CAGGCTGAGGAGGAAGGGGAGGG + Intronic
1152130152 17:78471734-78471756 CGGTCACAGTGGGCAGGGTAAGG - Intronic
1152603279 17:81276208-81276230 CTGTCACAGTGGGCAGGGCATGG + Intronic
1152937206 17:83146183-83146205 CAGAATCAGTGCCAAGGGGATGG - Intergenic
1153083354 18:1254841-1254863 AAGTCTCCATGGGAAGGTGAAGG + Intergenic
1153448012 18:5195937-5195959 CATTCTGAGGGGGAGGGGGAGGG + Intronic
1154351055 18:13583857-13583879 CAGGCTCAGAGGGAAGAGAATGG + Intronic
1154961150 18:21309899-21309921 CAGTGTGTGTGGGGAGGGGATGG - Intronic
1155620071 18:27768291-27768313 CAGTCTCAGTAGGAAGGAAGAGG + Intergenic
1156361523 18:36388401-36388423 CAGTCACAGTGGGACTGGGCTGG - Intronic
1156971544 18:43162986-43163008 CAGTCCCAGCAGGGAGGGGAGGG - Intergenic
1158544110 18:58381353-58381375 CAGACAAAGTGGGGAGGGGAGGG - Intronic
1159242514 18:65760689-65760711 CAGTCTCCTGGGGATGGGGAGGG - Intronic
1159528562 18:69626717-69626739 CAGTCTCTGTGAGAGGGTGAGGG - Intronic
1159638825 18:70839389-70839411 CAGTCTCTGTGGGAAGGTAGGGG + Intergenic
1159857150 18:73602510-73602532 CAGTCTCTGAGGGAATCGGATGG + Intergenic
1160745802 19:710168-710190 CACGCCCAGTGGGAAGGGCAGGG - Intronic
1161405851 19:4090745-4090767 GAGTCACAGTAGGACGGGGAGGG + Intronic
1162425698 19:10594155-10594177 CAGCCTCAGGGGGATGGGGGAGG - Intergenic
1162881470 19:13662812-13662834 CAATCTCAGAGGACAGGGGATGG - Intergenic
1163620617 19:18357651-18357673 CAGGCTCAGTGGGTGGAGGAGGG - Intronic
1163826686 19:19528154-19528176 CCGTCCCAGTGGGGAGGGGCAGG - Exonic
1164668719 19:30061075-30061097 CAGTATCAGTGGGCGGGGGCTGG - Intergenic
1165408564 19:35644611-35644633 CGGTCGGAGTGGGAAGGGGCGGG - Intronic
1165433321 19:35784400-35784422 CAGCTTCAGTGGGGTGGGGACGG - Intronic
1166140645 19:40803442-40803464 CTGTCTCACTGGGGAGGGGAGGG - Intronic
1166718738 19:44985586-44985608 CAGTCTCAGCCGGAAGTGGCAGG + Intronic
1166768476 19:45266206-45266228 CAATCTGGGAGGGAAGGGGAAGG - Exonic
1167602370 19:50461774-50461796 CAACCCCAGTGGGGAGGGGAGGG - Intronic
1168153205 19:54460063-54460085 CAGTCTCAGCTGGCAGGGCAGGG - Intronic
1168350722 19:55674310-55674332 CAGACACAGAGGGAAGGGGTTGG + Intronic
925710133 2:6731222-6731244 CAGTCTGAGTGGGCAGAGGCTGG + Intergenic
926337266 2:11873579-11873601 CATTGTCAGTGGTAAGTGGAAGG - Intergenic
926796146 2:16620768-16620790 CAGTCTCAGGAGGGAGGTGAAGG + Intronic
926890733 2:17637123-17637145 CCTTCCCTGTGGGAAGGGGAAGG - Intronic
927064858 2:19461067-19461089 CAGTTGCAGGGGGAGGGGGATGG - Intergenic
927207006 2:20617220-20617242 CAGTAGGAGTGGGGAGGGGATGG - Intronic
927487119 2:23496105-23496127 CAGTCTCAGGGGGCACGAGAGGG + Intronic
927973762 2:27322607-27322629 CATTGGAAGTGGGAAGGGGAAGG - Intronic
928082999 2:28326604-28326626 CAGTCTGAGAGGGAGGGGGATGG + Intronic
928433579 2:31239550-31239572 CACTGTCAATGGGAATGGGAGGG - Intronic
929662506 2:43802264-43802286 CAGTTTCTGTGGGAAGGTAAGGG - Intronic
930035680 2:47083759-47083781 CAGGCTCAAAGGGAAGGGGTTGG - Intronic
930163849 2:48184293-48184315 CAGCCTCAGTGGGAATGGAAAGG - Intergenic
931990188 2:67782552-67782574 CAGGCTTGGTGGGAAGGTGATGG - Intergenic
932669813 2:73727750-73727772 CAGTCTCTGTGGGATGGTGGGGG + Intergenic
932916532 2:75865213-75865235 CAGTCTCAGTGGGTTGGGCTTGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934819306 2:97358140-97358162 CAGTCTGAGAGGGAAGGACAGGG + Intergenic
935162363 2:100540331-100540353 AAGTCTAAGTGGGTAGGGGGAGG + Intergenic
935195227 2:100809823-100809845 CAGAGACAGTGGGAATGGGAAGG + Intergenic
935615945 2:105082109-105082131 CACTCACAGTGGGAAGGGGACGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936024189 2:109018692-109018714 GAGTGCCAGTGGAAAGGGGATGG - Intergenic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936300148 2:111298763-111298785 CAGTCTCTGTGGCAGGGGAAAGG - Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936606038 2:113955456-113955478 CTGTCTCAGAGGAAAGGGGTTGG - Intronic
937218732 2:120329312-120329334 CAGTATCTGTGCGAAGGGGATGG - Intergenic
937258321 2:120569992-120570014 AACTCTCAGTGGGAACTGGAAGG + Intergenic
937856828 2:126678442-126678464 CAGGCTCAGTGGGATGGGGAGGG - Intronic
938036185 2:128036983-128037005 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
938036991 2:128043051-128043073 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
938639410 2:133264751-133264773 CAGTCAGACTGGGAAGGAGAAGG + Intronic
939176519 2:138754341-138754363 AAGGTTCAGAGGGAAGGGGAAGG - Intronic
939668195 2:144976792-144976814 CAGCAGCAGTGGGAGGGGGAAGG - Intergenic
939901041 2:147849783-147849805 CAGTATCAGAGAGAAGGGTATGG - Intronic
940460490 2:153958217-153958239 AACTCTCAGTGGGTTGGGGAGGG - Intronic
941140416 2:161773966-161773988 CAGTGGCAGTGGGAATGGAAGGG - Intronic
942315243 2:174691637-174691659 GAGTTTCAGTGGGAAAGGCAGGG + Intergenic
942738372 2:179142553-179142575 TAGGCACAGTGGGAAGTGGATGG - Intronic
944218382 2:197278128-197278150 CAGTATCAGTGGGGACGGGAGGG + Intronic
944359948 2:198842182-198842204 GAGAACCAGTGGGAAGGGGAAGG + Intergenic
944986427 2:205182887-205182909 CAGTCTCAGTGGTTATGAGAGGG - Intronic
946564957 2:220954086-220954108 CAGCCTCACTGGGAAGTGAAAGG + Intergenic
947745252 2:232503839-232503861 CGGTCTCAGCGGGAAGGTGTTGG - Intergenic
948511662 2:238470224-238470246 CAAACCCAGTGGGGAGGGGAAGG + Intergenic
948589259 2:239038899-239038921 CCTTCTCAGTGAGAAGGGGCTGG + Intergenic
948883827 2:240873326-240873348 CAGAAGCAGTGGGAAGAGGAAGG + Intronic
1168859353 20:1034826-1034848 CAGTTTCATTGGGAAGTGGCAGG + Intergenic
1169046467 20:2537714-2537736 CATTCCCAGTGGGAAGGTGATGG - Intronic
1169554667 20:6736443-6736465 CATTCTAAGTGGGAAGGGTGGGG + Intergenic
1170876049 20:20251202-20251224 CAGCCTCAATGGGAATGAGAAGG - Intronic
1171304770 20:24095822-24095844 CAGAGCCAGTGGGAAAGGGAGGG - Intergenic
1172057536 20:32164951-32164973 CAGTCGGAGTGGGTGGGGGAGGG - Intronic
1172792588 20:37516078-37516100 CAGTCACTTTGGGAAGGGGTGGG + Intronic
1172814699 20:37677121-37677143 CAGTCTCAGAGGGGAGAGGAAGG - Intergenic
1172833326 20:37855598-37855620 CAGCCTACGTGAGAAGGGGAAGG - Intronic
1173021612 20:39272281-39272303 CCGTGTCAGTGGAAAGGGGTGGG - Intergenic
1174121268 20:48267563-48267585 CAATATCAGTGGGCAGAGGATGG + Intergenic
1174336658 20:49866716-49866738 AAGTCTCAAGGGGAAGAGGAAGG - Intronic
1174370248 20:50082134-50082156 CAATCTCAGAGGGGAGTGGAGGG + Exonic
1174435006 20:50499997-50500019 GACTCACTGTGGGAAGGGGAGGG - Intergenic
1174449119 20:50609051-50609073 CAGTTTCAGTGGGGTGAGGATGG + Intronic
1174542975 20:51304208-51304230 AACTCTCAGTGGAGAGGGGATGG + Intergenic
1174787653 20:53447619-53447641 CAGTCACAGATGGAAAGGGAAGG - Intronic
1174881588 20:54285108-54285130 CAGTCTCAGGGACAGGGGGAAGG - Intergenic
1174910615 20:54603891-54603913 TAGCCTCAGGGGGAGGGGGAGGG + Intronic
1175486633 20:59351587-59351609 AAGTCTCATGGGGAAGGAGATGG - Intergenic
1175687663 20:61043457-61043479 CAGTCTCAGGGGGTATGGCAGGG - Intergenic
1175730344 20:61349972-61349994 CTGTCCCAGTGGGCAGGGGCAGG - Intronic
1175830934 20:61965401-61965423 CAGGCTCTGCGGGGAGGGGAGGG - Intronic
1176002111 20:62836866-62836888 AAGCCTGAGTGGGAAGGTGAAGG - Intronic
1176246045 20:64097600-64097622 CAGTCTCAGGGGGTAGGGCCTGG - Intronic
1176360107 21:5988142-5988164 CACACCCAGTGGGAAGGGGAAGG - Intergenic
1178152440 21:29810981-29811003 CAGTCTCAGGGGGAACATGAAGG - Intronic
1179763411 21:43550408-43550430 CACACCCAGTGGGAAGGGGAAGG + Intronic
1181098456 22:20522422-20522444 CAGTGACAGTAGGAAGGGAAAGG + Intronic
1181643144 22:24215300-24215322 CAGTCTTCATGGGCAGGGGAGGG - Intergenic
1181712268 22:24697942-24697964 CAGTCACATGAGGAAGGGGAAGG - Intergenic
1181815478 22:25433593-25433615 AAGACTCTGTCGGAAGGGGAAGG + Intergenic
1182586532 22:31346801-31346823 CACTCTCAGCGGGCAGGGGAGGG - Intergenic
1183015617 22:34984066-34984088 GGGTGTCAGTGGGAAGGGGAGGG - Intergenic
1183354668 22:37351718-37351740 CAGTCTGAGCGGGAAGGGCTCGG - Intergenic
1185083040 22:48720307-48720329 CAGTGTCAGAGGGATGGGAACGG - Intronic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
952833898 3:37588410-37588432 CAGCCTCTGTGGGGAGGGGGTGG - Intronic
952888411 3:38025363-38025385 GAGTCCCAGTGGGAGGTGGATGG + Intronic
954538536 3:51379015-51379037 CAGGCTCAGTGGGAAAAGCAGGG - Intronic
955371206 3:58353801-58353823 CAGTCTGACTGGGTAGAGGAGGG + Intronic
956682774 3:71796900-71796922 CACTTTCCCTGGGAAGGGGAAGG - Intergenic
957051619 3:75416143-75416165 TGGTCTCAATGAGAAGGGGAGGG + Intergenic
958450470 3:94266808-94266830 GAGGCTAGGTGGGAAGGGGAGGG - Intergenic
958782040 3:98554358-98554380 CAGTCTTACTTGGAAGTGGAAGG - Intronic
958888706 3:99758803-99758825 CAGTCTCAGTGGTAGGTGCAGGG - Intronic
961302859 3:125933452-125933474 CAGTCTCAATGAGAAGGGGAGGG - Intronic
961670438 3:128524509-128524531 GGGACTCAGTGGGGAGGGGAGGG - Intergenic
961822933 3:129584508-129584530 CAGCCTCAGTGGCATGGAGATGG - Exonic
961885210 3:130092323-130092345 CGGTCTCAGTGAGAAGGGGAGGG + Intronic
962411571 3:135145659-135145681 CAATCCCAGTGAGATGGGGAGGG + Intronic
962471957 3:135716950-135716972 CTGGTACAGTGGGAAGGGGAAGG + Intergenic
962872909 3:139513649-139513671 CTGTCTCAGTAGCAAGGAGAGGG - Intergenic
964374489 3:156035794-156035816 CCGACTCAGAGGGAAGGGAAGGG - Intergenic
964716556 3:159728598-159728620 CAGCCTCACTGGGAAAGAGAGGG - Intronic
964716731 3:159730778-159730800 CAGCCTCACTGGGAAAGAGAGGG - Intronic
965074086 3:163953904-163953926 CCGTCCAAGTTGGAAGGGGACGG + Intergenic
965969127 3:174532167-174532189 CAGTTTCTGGGGGAAGGAGAAGG + Intronic
967999982 3:195198847-195198869 TATTCTCAGTGGTGAGGGGAGGG - Intronic
968923681 4:3535861-3535883 AAGGCACAGTGGGCAGGGGATGG + Intergenic
969819538 4:9709714-9709736 CAGTCTCAGTGAGAAGGGGAGGG - Intergenic
971974190 4:33662299-33662321 CAGAAGTAGTGGGAAGGGGAAGG - Intergenic
972375754 4:38468641-38468663 CACTCTCAGTTGAAAAGGGAGGG - Intergenic
973136349 4:46711974-46711996 CATTAACAGTGGGAAGGAGATGG - Intergenic
974453396 4:62094683-62094705 CAGTCTCAGTGAGAAGAGCCAGG + Intergenic
974674853 4:65076500-65076522 CAGCCCCAGCGGGGAGGGGATGG - Intergenic
975512740 4:75211526-75211548 CAGCCTAAGTGGGAGTGGGAGGG + Intergenic
976219300 4:82743044-82743066 GAGTCTCAGTGGAAAGGGCTGGG - Intronic
978067594 4:104424737-104424759 CAGTGTCAGTGAGAGGGGGAGGG + Intergenic
978931086 4:114312808-114312830 GAGAATCAGAGGGAAGGGGAAGG - Intergenic
979528647 4:121744361-121744383 GAATCTCAGTGGGAATGGTAGGG + Intergenic
980110944 4:128636319-128636341 CAGCCTCAGGGGTGAGGGGAAGG - Intergenic
980613231 4:135184916-135184938 CAGCCTCAGCTGGAAGGAGAGGG + Intergenic
980731338 4:136827888-136827910 CAGTGTGTGTGGGAAGGAGAGGG + Intergenic
984187020 4:176557222-176557244 CATCCTCAGTGGTTAGGGGATGG + Intergenic
985495407 5:201872-201894 CAGTTTCCTTGGGGAGGGGAGGG - Exonic
987187468 5:15439495-15439517 CAGGTTCAATGGAAAGGGGAAGG + Intergenic
987802023 5:22710756-22710778 CAGCCTCAGTGGAGAGGGCATGG + Intronic
988097346 5:26633799-26633821 TTGTCTTAGTGTGAAGGGGAGGG - Intergenic
989982999 5:50666166-50666188 CAGGCACTGAGGGAAGGGGAGGG + Intronic
992311561 5:75506115-75506137 CACTGGGAGTGGGAAGGGGAAGG + Exonic
992330643 5:75714484-75714506 AAGTAGCAATGGGAAGGGGATGG + Intronic
992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG + Intergenic
993105767 5:83598890-83598912 TATTTTCAGAGGGAAGGGGAGGG + Intergenic
995393796 5:111666554-111666576 CAGCCTCTGCAGGAAGGGGAGGG + Intronic
995664345 5:114524391-114524413 CAGAGTCAGTGGGAAGCGAAAGG - Intergenic
995803339 5:116023588-116023610 CACTGGCACTGGGAAGGGGAAGG + Intronic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
999032181 5:148306331-148306353 GAGGCTAGGTGGGAAGGGGAGGG - Intergenic
999654242 5:153797025-153797047 AACATTCAGTGGGAAGGGGAAGG - Intronic
1001304713 5:170563254-170563276 CAGGCCCAGTGGTAAAGGGAAGG + Intronic
1001955027 5:175843094-175843116 CAGGGTCAGCGGGTAGGGGAGGG + Intronic
1002395949 5:178954719-178954741 CAGGCCCTGTGGGCAGGGGAAGG - Intronic
1002913896 6:1513339-1513361 CTGTGTCAGTGGGGAGGGGTTGG - Intergenic
1002934832 6:1662540-1662562 CAGTCTCAGAGAGGTGGGGAGGG + Intronic
1003237307 6:4307346-4307368 CAGTCTCAGTAGCAAGGACAGGG + Intergenic
1003616741 6:7661120-7661142 GACTCTCAGTGGGAAAGGGGAGG + Intergenic
1004034016 6:11904032-11904054 CAGTCTCTGCGGGTGGGGGAAGG + Intergenic
1004055675 6:12135958-12135980 CAGAATCAGTGGGAATGGAAAGG - Intronic
1005389985 6:25323254-25323276 TATTCTCAGTGAGAAGGAGAAGG + Intronic
1005497293 6:26398892-26398914 GAGTTTTAGTGGGAAGGTGAAGG - Intergenic
1006124184 6:31827184-31827206 CCGTCTTAATGGGAAGGAGAAGG - Intergenic
1006189084 6:32196672-32196694 CAGTGTCTGTGGAAAGGGGGGGG - Intronic
1006835470 6:36996311-36996333 GAGTCTCCGGGGGAAGGGAAAGG + Intergenic
1006910150 6:37558393-37558415 CAGTTTCACTGGGGAGGGGCCGG + Intergenic
1008326448 6:50187819-50187841 CAATGGCGGTGGGAAGGGGAGGG - Intergenic
1009319173 6:62264946-62264968 GAGTTTCAGTGGGTAGGGGCAGG - Intronic
1009641694 6:66345659-66345681 CATTCTCAACTGGAAGGGGATGG + Intergenic
1016782579 6:147976114-147976136 CAGTGTAAATGGGAAGGTGATGG + Intergenic
1017384823 6:153871228-153871250 CAGTCGCAGTGGGAAGGAGAAGG + Intergenic
1017884938 6:158591200-158591222 CAATCTCAGAGGGGAGGAGACGG - Intronic
1018062914 6:160104475-160104497 CAGTCTCATTAGGAACAGGAAGG + Intronic
1018703312 6:166445217-166445239 CAGTCACAGTGGGGTGGGGGTGG + Intronic
1019407948 7:893731-893753 CTGTCCCAGTGGGAAGCTGACGG + Exonic
1019664092 7:2242630-2242652 CAGTCTCAGTGAAATGGGAAAGG + Intronic
1020318682 7:6924886-6924908 CAGTCTCAATGAGAAGGGGAGGG + Intergenic
1020435293 7:8155854-8155876 CATTGCCAGTGTGAAGGGGAAGG + Intronic
1021603992 7:22392764-22392786 CAGCATCATTGGGATGGGGATGG - Intergenic
1021853013 7:24826972-24826994 CAGTCTGAGTTGGAAAGTGATGG - Intronic
1022928879 7:35088259-35088281 AAGGCTGAGTGGGAAGGGTAGGG - Intergenic
1023018393 7:35987603-35987625 CAGTCTTAGTGGGTAGGAGAAGG + Intergenic
1023104632 7:36751431-36751453 CAGTCTCACAGAGAAGAGGAGGG - Intergenic
1023133813 7:37031070-37031092 CAGTGGCAGTGGGAAAGGAAAGG - Intronic
1023694336 7:42829334-42829356 CAGCATCACTGTGAAGGGGAAGG - Intergenic
1023836622 7:44072453-44072475 CTGCCTCAGTGAGAAGGGGAGGG + Exonic
1024120298 7:46229973-46229995 CTGGCTCAGTGGGAGGGGAAAGG + Intergenic
1025723474 7:64037171-64037193 CGGGCTCAGTGGGAGGGGCAGGG - Intronic
1025752614 7:64306766-64306788 CGGGCTCAGTGGGAGGGGCAGGG - Intergenic
1026775841 7:73230508-73230530 CAGGTTCAGTGGGAAGCTGAAGG + Intergenic
1027016699 7:74783880-74783902 CAGGTTCAGTGGGAAGCTGAAGG + Intronic
1027071329 7:75162056-75162078 CAGGTTCAGTGGGAAGCTGAAGG - Intergenic
1029514662 7:101017803-101017825 GAGTCCCAGGGGGAAGGGAAAGG - Intronic
1029514701 7:101017885-101017907 GAGTCCCAGGGGGAAGGGAAGGG - Intronic
1029514743 7:101017967-101017989 GAGTCCCAGGGGGAAGGGAAGGG - Intronic
1029514764 7:101018008-101018030 GAGTCCCAGGGGGAAGGGAAGGG - Intronic
1029514785 7:101018049-101018071 GAGTCCCAGGGGGAAGGGAAGGG - Intronic
1029514828 7:101018131-101018153 GAGTCCCAGGGGGAAGGGGAAGG - Intronic
1029514850 7:101018173-101018195 GAGTCCCAGGGGGAAGGGAAGGG - Intronic
1029617107 7:101665965-101665987 CCTTCCCAGTGGGCAGGGGATGG - Intergenic
1029824987 7:103181934-103181956 GAGGCTGAGTGGGAAGGGTAGGG - Intergenic
1030079034 7:105761687-105761709 CAGTTTCAGGGGGAATGGAATGG + Intronic
1032738031 7:134710835-134710857 CAGTCTCAATGGGAGGGGGAAGG + Intergenic
1033207840 7:139437925-139437947 CAAACTCAGTGGGCAGGGGTGGG - Intergenic
1033314164 7:140283847-140283869 CAGTCTCTATGGGAAGGGGATGG - Intergenic
1033540195 7:142349320-142349342 CAGCTCCAGTGGAAAGGGGATGG - Intergenic
1033558207 7:142507469-142507491 CAGCCCCAGTGGAAAGGGGATGG - Intergenic
1034341599 7:150360450-150360472 CAGTCTCCATGGGAGGGAGAGGG - Intergenic
1034491732 7:151396487-151396509 CAGGAGCAGCGGGAAGGGGATGG + Intronic
1034899428 7:154898387-154898409 CACGATCAGAGGGAAGGGGAGGG + Intergenic
1035523619 8:294521-294543 CAATCTCAGAGGCCAGGGGATGG - Intergenic
1036381733 8:8240306-8240328 CGGTCTCAATGAGAAGGGGAGGG - Intergenic
1036502799 8:9328994-9329016 CAGGATCAGTGGGAAGAGGTAGG - Intergenic
1036746286 8:11412339-11412361 CAATCTCAGTGGGGAGTGGAGGG + Intronic
1037710388 8:21350899-21350921 CAGGCACAGTGGGAAGGAGGAGG + Intergenic
1038044147 8:23751986-23752008 GTGTATCTGTGGGAAGGGGAAGG + Intergenic
1038248220 8:25878817-25878839 CAGTCGGAGTGAGGAGGGGAGGG - Intronic
1039239984 8:35545742-35545764 GAGTGGCAGTGGGAAGGTGAGGG - Intronic
1039610850 8:38918075-38918097 GAGGGTCAGTGGGAAGGGGTGGG + Intronic
1040534713 8:48298515-48298537 CAGTCTCTTAGGGAAGGGTAGGG + Intergenic
1042289572 8:67155216-67155238 AAGTGTGAGTGTGAAGGGGAGGG - Intronic
1042392409 8:68251043-68251065 CAGGGGCTGTGGGAAGGGGATGG + Intergenic
1043401096 8:79885071-79885093 CAGGCTAAGTGGGAGGGGGAAGG + Intergenic
1045302129 8:100920781-100920803 AAGTTTCAGTGGGATGGGGGGGG + Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045799840 8:106089466-106089488 CATTCTCAGCAGGAAAGGGAGGG - Intergenic
1047189666 8:122666606-122666628 TAGTATCAGTGGGGTGGGGAAGG - Intergenic
1048016219 8:130499929-130499951 GAGTCTCATTGGAAAGGGGAAGG - Intergenic
1049478525 8:142807998-142808020 CAGCCTCTGAGGGGAGGGGAGGG + Intergenic
1049641408 8:143717631-143717653 CAATCTGGGTGGGCAGGGGATGG + Intronic
1049699859 8:144005632-144005654 CAGCCACTGTGGGGAGGGGACGG - Intronic
1050057852 9:1674349-1674371 CAGTCTCATTTGGATGGGCATGG - Intergenic
1050589974 9:7150585-7150607 CACACTCAGAGGGAAGGAGAAGG + Intergenic
1050950355 9:11583804-11583826 CAGTCTCAGTGGAGAGTGGGTGG - Intergenic
1051220434 9:14843171-14843193 CAGTGTCAGAGGGAAGAAGATGG - Intronic
1054145824 9:61560114-61560136 AAGGCACAGTGGGCAGGGGATGG - Intergenic
1054187803 9:61966944-61966966 AAGGCACAGTGGGCAGGGGATGG + Intergenic
1054465567 9:65491218-65491240 AAGGCACAGTGGGCAGGGGATGG - Intergenic
1054650713 9:67621637-67621659 AAGGCACAGTGGGCAGGGGATGG - Intergenic
1055101261 9:72468001-72468023 CAGGATCAGTGTGGAGGGGAGGG + Intergenic
1055658377 9:78475064-78475086 CACTCACAGTGGGAAGAGGAGGG + Intergenic
1057531979 9:95857040-95857062 CATTCCTAGGGGGAAGGGGAAGG - Intergenic
1058225237 9:102352955-102352977 CAGACTGAGAGGGAAGTGGAGGG - Intergenic
1059312057 9:113395331-113395353 CAGCCTCAGTGGGAGAGGGAAGG - Intronic
1059427240 9:114228769-114228791 CAGTCTCACTGAGAAAGTGAGGG - Intronic
1059985048 9:119813425-119813447 CAGACTCATTAGGTAGGGGAGGG + Intergenic
1060418475 9:123450146-123450168 GACTCTGAGTGGGGAGGGGAGGG - Intronic
1061182712 9:129034437-129034459 GAGACTCCGTGGGGAGGGGAGGG - Intergenic
1061831986 9:133301996-133302018 CAGTGTCAGTGGGTAGAGGCTGG - Intergenic
1062273298 9:135719516-135719538 GAGTCCCAGTGGGGAGGGGTGGG + Intronic
1062349911 9:136133489-136133511 CCGTCTCAGGAGGAAGGGAAGGG - Intergenic
1185948902 X:4408427-4408449 CAGTATCAGCGGGTCGGGGAGGG + Intergenic
1186524401 X:10235223-10235245 CTTTCTAAGTGGGAAGAGGAAGG + Exonic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1189161822 X:38817162-38817184 GAATCGCAGTGGGGAGGGGAGGG - Intergenic
1189417553 X:40828536-40828558 AAGTGTCAGTGGGAAGGTGCTGG + Intergenic
1189781038 X:44514571-44514593 CAGGCTCTGTGGAAAGGGGCAGG - Intergenic
1190777186 X:53562313-53562335 CAGGCTGAGTGGGAAGGTGATGG + Intronic
1191209652 X:57871691-57871713 GAGTCCCTGTGGGAAGGGGTGGG - Intergenic
1192344485 X:70289974-70289996 CCGGCGCGGTGGGAAGGGGAGGG - Exonic
1192723835 X:73727440-73727462 CAGCCACAGTGGTAAGGGGGAGG - Intergenic
1192898477 X:75470113-75470135 TTGACTCAGTGGGATGGGGAAGG + Intronic
1193248732 X:79262822-79262844 CAGTCTTAGTGGGAAATGAAAGG + Intergenic
1193862583 X:86688416-86688438 CAGTGTCAGTGGGAATGGAAGGG + Intronic
1194269309 X:91790970-91790992 CAGTTTCATCGGGAAGGTGATGG - Intronic
1195055174 X:101137541-101137563 CAGTTACAGTGGGATTGGGAAGG + Intronic
1196117571 X:112014082-112014104 CAGTAGAAGTGGGATGGGGATGG + Intronic
1197422686 X:126258129-126258151 CAGTGGCAGTGTGAAGGGGCAGG + Intergenic
1197825872 X:130589802-130589824 CAGTGACAGTAGGAAGGGAAAGG - Intergenic
1197864881 X:131007230-131007252 CAATTTCAGTGAGAAGGAGATGG + Intergenic
1198035218 X:132795139-132795161 GAGACTGAGAGGGAAGGGGATGG + Intronic
1198321508 X:135521929-135521951 CGCTCTCAGCAGGAAGGGGAGGG - Intronic
1198778084 X:140202296-140202318 CAGGCTCAGGGGGAAGGACAAGG - Intergenic
1199552980 X:149077961-149077983 CACTTTCAGTGGTCAGGGGATGG - Intergenic
1199608416 X:149594392-149594414 CAGTTTCTGTGGAAAGGGGAGGG + Exonic
1199630704 X:149774968-149774990 CAGTTTCTGTGGAAAGGGGAGGG - Exonic
1199684819 X:150256512-150256534 CAGTGCCAGTGGGAATTGGAAGG + Intergenic
1199853563 X:151741839-151741861 CAGTCTCAGTGGGAAGGGGAGGG + Intronic
1199886974 X:152029927-152029949 CAGTGTCAGTGGGTAGGAGGTGG - Intergenic
1200054969 X:153455486-153455508 CAGTCTGAGTGAACAGGGGAGGG + Intronic
1200210447 X:154344663-154344685 CAGTCCCAGTGGGAAGGATGGGG - Intergenic
1200220405 X:154387429-154387451 CAGTCCCAGTGGGAAGGATGGGG + Intergenic
1200586529 Y:5011955-5011977 CAGTTTCATCGGGAAGGTGATGG - Intronic
1201283259 Y:12358971-12358993 CTCTCTCAGTGGGAGGAGGAGGG + Intergenic
1201371566 Y:13269889-13269911 CAGTCCCAGTGAGATGAGGAGGG + Intronic
1201489397 Y:14524606-14524628 CCGTGGCAGTGGGGAGGGGACGG - Intronic