ID: 1199853878

View in Genome Browser
Species Human (GRCh38)
Location X:151744193-151744215
Sequence TCTAGGACTTTCTTGGCATC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199853878_1199853883 -10 Left 1199853878 X:151744193-151744215 CCTGATGCCAAGAAAGTCCTAGA 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1199853883 X:151744206-151744228 AAGTCCTAGAAGAGAGGGGTCGG 0: 1
1: 0
2: 3
3: 16
4: 287
1199853878_1199853888 10 Left 1199853878 X:151744193-151744215 CCTGATGCCAAGAAAGTCCTAGA 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1199853888 X:151744226-151744248 CGGGAGATCCTCATGAAGGAGGG 0: 1
1: 0
2: 1
3: 3
4: 121
1199853878_1199853890 18 Left 1199853878 X:151744193-151744215 CCTGATGCCAAGAAAGTCCTAGA 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1199853890 X:151744234-151744256 CCTCATGAAGGAGGGACTGCTGG 0: 1
1: 0
2: 4
3: 23
4: 285
1199853878_1199853887 9 Left 1199853878 X:151744193-151744215 CCTGATGCCAAGAAAGTCCTAGA 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1199853887 X:151744225-151744247 TCGGGAGATCCTCATGAAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 100
1199853878_1199853884 -9 Left 1199853878 X:151744193-151744215 CCTGATGCCAAGAAAGTCCTAGA 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1199853884 X:151744207-151744229 AGTCCTAGAAGAGAGGGGTCGGG 0: 1
1: 0
2: 1
3: 20
4: 183
1199853878_1199853886 6 Left 1199853878 X:151744193-151744215 CCTGATGCCAAGAAAGTCCTAGA 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1199853886 X:151744222-151744244 GGGTCGGGAGATCCTCATGAAGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199853878 Original CRISPR TCTAGGACTTTCTTGGCATC AGG (reversed) Exonic
903333876 1:22612287-22612309 TCTAGGATTCTCATGGCAGCAGG + Intergenic
905561259 1:38929186-38929208 TCTGGGACTGTCTAGGCAGCTGG - Intronic
905678161 1:39844785-39844807 TCTAGGTCTTTCTTGGATTGTGG - Intronic
905974712 1:42165909-42165931 CCTAGGGCTGTCCTGGCATCGGG - Intergenic
909538372 1:76764043-76764065 TCCAGGAGTTTCTTGGCCTGTGG + Intergenic
909831598 1:80198270-80198292 TCTGGAAATTTCTTGGCTTCTGG + Intergenic
910331439 1:86076872-86076894 TCTAGGACTTTTATGGTTTCAGG - Intronic
910449401 1:87330840-87330862 ACTAGGACTTTATTGGACTCGGG + Intronic
912466036 1:109874692-109874714 TCTACTACTTTCTTTCCATCTGG - Intergenic
915283089 1:154836111-154836133 TCTTGGAGTTTCTTGACATTAGG - Intronic
917459331 1:175216002-175216024 TCTAGGACTCTTTGGGCCTCAGG - Intergenic
919130767 1:193447511-193447533 TCCATAACTTTCTTGGCAACTGG - Intergenic
920034559 1:203057475-203057497 TCTAGTACATGCTTGGCATGTGG + Intronic
922220548 1:223554973-223554995 TCTAGAAATTTCGTGTCATCTGG - Intronic
923511007 1:234653432-234653454 TCTAGGAGTTTCATGGTTTCAGG - Intergenic
923828806 1:237530422-237530444 TCCAGGACTTTGTTGGCATTAGG + Exonic
1063683708 10:8215139-8215161 ACTGGGACTTTTTCGGCATCTGG - Intergenic
1064898001 10:20261301-20261323 TCTAGGAATTTGATGGCTTCAGG + Intronic
1065867629 10:29927561-29927583 TCTTGGCCTTTCTTGCCATTAGG + Intergenic
1067350663 10:45472865-45472887 TGGAGGAGTTTCATGGCATCAGG - Intronic
1068386545 10:56335723-56335745 TCTAGGACTGCCCTGGCACCAGG - Intergenic
1068564045 10:58551180-58551202 CCTAGGACTTGCCTGGCATCTGG + Intronic
1068777882 10:60887705-60887727 TCAAGGACTTTAGTGGCCTCAGG + Intronic
1068863060 10:61867140-61867162 TTTGGGACTTGGTTGGCATCTGG + Intergenic
1069610468 10:69769323-69769345 TCTAGGAGTTTCCTGGGATTTGG - Intergenic
1071669409 10:87594159-87594181 CCTAGGACTTTCTTAGCTTTTGG + Intergenic
1072261060 10:93673726-93673748 TCAAGGACTTACTTTGCGTCAGG + Intronic
1072276709 10:93830286-93830308 TTTTGGCATTTCTTGGCATCTGG - Intergenic
1073719527 10:106151377-106151399 TCTAGGAATTTTATGGCTTCTGG - Intergenic
1073781563 10:106844421-106844443 TCTAGGAGTTTCATGGTTTCAGG + Intronic
1076603981 10:131677600-131677622 TCCAGGTCTTTCCTTGCATCTGG - Intergenic
1077716321 11:4584370-4584392 TCTAGTCCATTCTTGGCATCTGG + Intergenic
1079290988 11:19187598-19187620 TCTAGCACTGTATTGGCAACAGG + Intronic
1081194944 11:40150077-40150099 TCTAGGTCTTCCTTGGCTTGTGG + Intronic
1082092293 11:48099982-48100004 CCTTGGACTTTCTTGGCACGTGG + Intronic
1084752346 11:71212765-71212787 TTTAGGACGTTCTTGCCACCAGG + Intronic
1085460552 11:76690498-76690520 TCTGGGACCTTCTTGGCAATTGG + Intergenic
1087593989 11:100231068-100231090 TCTAGAACTGTCCTGGCATGTGG - Intronic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1089242379 11:117092902-117092924 TCTATGACTTTCTAGGGAGCTGG + Intronic
1093410190 12:18856089-18856111 TCTAGGAGTTTCATGGTTTCAGG - Intergenic
1095123611 12:38447842-38447864 TCTTGGACTTTCTAGCCTTCAGG - Intergenic
1095565644 12:43620812-43620834 TCTAGTATTTTCTTAGCTTCAGG + Intergenic
1095660778 12:44732583-44732605 TGTAGGAGTTTCTTAGCTTCAGG - Intronic
1098635111 12:72774041-72774063 CCTAGGATTTTCTTGGCAACAGG - Intergenic
1100765815 12:97864278-97864300 TCTAGGTGTTTCTTGGCTTGTGG + Intergenic
1103059606 12:117847924-117847946 TCAAGCACTTTCTCTGCATCTGG - Intronic
1103864393 12:124040346-124040368 CCTAGGACTTCCTGGGGATCAGG + Intronic
1104096602 12:125563848-125563870 TCCAGGAGTTCCTTGGCTTCTGG - Intronic
1105299671 13:19120297-19120319 TCTAGTACTTTCATGGTTTCTGG + Intergenic
1105613762 13:21993129-21993151 TCTAGGAATTTTTTGGTTTCAGG + Intergenic
1107405199 13:40105843-40105865 CATAGGACCTTCTTGGCCTCAGG - Intergenic
1107795985 13:44052326-44052348 TCTATGACATTCTTTACATCAGG - Intergenic
1111432296 13:88160082-88160104 TCTAGGAATCTCATGGCATGAGG - Intergenic
1111720410 13:91936671-91936693 TCTAGGATTTTCTTTGCTCCAGG + Intronic
1111776547 13:92670395-92670417 TAGAGGACTTTCTTGGCAGAGGG + Intronic
1112702487 13:102027727-102027749 TTTAGGACATTGTTGGAATCTGG + Intronic
1115328476 14:32168198-32168220 TGTAGGACTTTCCTGGAATGTGG - Intergenic
1118381639 14:65222479-65222501 TCTAGAAAATTCCTGGCATCTGG - Intergenic
1120379714 14:83760732-83760754 TCTAAAACTTTATTAGCATCAGG + Intergenic
1121007575 14:90500152-90500174 TCTAGCACTTTCTCTGCACCAGG - Intergenic
1121889321 14:97574338-97574360 TGCAGGACTGCCTTGGCATCAGG - Intergenic
1124071397 15:26396386-26396408 ACTAGGAATTAATTGGCATCAGG - Intergenic
1124418594 15:29495500-29495522 TCTAGGAGTTTTGTGGCTTCAGG + Intronic
1126166524 15:45658649-45658671 TCGAGGACTTTGTTTGAATCAGG - Intronic
1126528153 15:49681254-49681276 TCTAGGACTTTTATGGCTTCAGG - Intergenic
1129497432 15:75998481-75998503 TCTGGAACTTTCCTGGCATCAGG + Intronic
1129859436 15:78848945-78848967 TCTAGGAATTCTTTGCCATCTGG + Intronic
1130228473 15:82078331-82078353 TCTAGGAGCATCTGGGCATCTGG + Intergenic
1130248904 15:82282553-82282575 TCTGGTACTTTCTTGACCTCAGG - Exonic
1130451150 15:84053598-84053620 TCTGGTACTTTCTTGACCTCCGG + Intergenic
1132991004 16:2793904-2793926 TCTAGGAATTTTATGGCTTCAGG + Intergenic
1136540467 16:30925264-30925286 TCTAGGAATCTCTGGGTATCTGG + Intronic
1136545020 16:30949719-30949741 TTTAGGACTTTCGTGTCCTCCGG - Intronic
1137686955 16:50392874-50392896 TCTGGGGCTTTCTGAGCATCAGG + Intergenic
1141515537 16:84542338-84542360 TCTAGGACATTCTAGGCTTTTGG - Intronic
1141803689 16:86328220-86328242 TCCAGGACTCTCTTGGACTCTGG + Intergenic
1143322192 17:6075515-6075537 TCTATTACTTTGTTGCCATCTGG - Intronic
1144210292 17:13008717-13008739 TCCAGGAGTCTCTTGGCATGAGG - Intronic
1144301507 17:13925913-13925935 TCTAGCACTTTCCTGACCTCTGG - Intergenic
1144771287 17:17760950-17760972 TCTAGGAGGTTCTTGGCAAGGGG - Intronic
1145789772 17:27619118-27619140 TCAGGGGCTTTCTTGGCAGCGGG - Intronic
1147471836 17:40669645-40669667 TCTAGGAGTTTAATGGCTTCAGG - Intergenic
1148986703 17:51628740-51628762 TCTAGGACTTTGGTCTCATCTGG - Intergenic
1151245848 17:72794037-72794059 TCTAGGCCATTGTTAGCATCAGG + Intronic
1155362320 18:25015814-25015836 TCTAGGACTTGAGTGGCATCAGG - Intergenic
1158196541 18:54892409-54892431 GCAAGGACTTTATTGGAATCTGG + Exonic
1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG + Intronic
1158680742 18:59564652-59564674 TCTATGTCTTTCATAGCATCTGG + Intronic
1159733166 18:72057628-72057650 TCTAGGAACATCTTGGCCTCTGG + Intergenic
1160068648 18:75604507-75604529 TCTAGGGCTTTTTTGGCTTTAGG - Intergenic
1166269287 19:41704102-41704124 GCTGGGAGTTTCTTGGCACCTGG + Intronic
1168695200 19:58400319-58400341 CCTAGGAGTTGCTGGGCATCTGG + Intergenic
926858527 2:17283245-17283267 TCTACAACTTGCTTGGCAGCAGG - Intergenic
931024051 2:58088024-58088046 TCCATGACTTTCTTGCCATATGG - Intronic
932197251 2:69795569-69795591 TCTAGCCCTTTCCTGGCCTCTGG + Intronic
933067120 2:77811385-77811407 TCTAGGGCTTTTTTGGTATTAGG - Intergenic
934928214 2:98396944-98396966 TCCAGGGCCTTCTTGGCTTCGGG - Exonic
935262509 2:101367612-101367634 ATTAGGACTTCTTTGGCATCTGG - Intronic
936327033 2:111514092-111514114 TGTAGAATTTTCTGGGCATCTGG + Intergenic
937429059 2:121823415-121823437 TCAAGGATTTTCTTGGCCCCTGG + Intergenic
938010160 2:127822341-127822363 TCTAGCACTTTCCTAGCTTCTGG - Intergenic
940149281 2:150581305-150581327 TCTAGGTGTTTCTTGGCTTGTGG - Intergenic
941253412 2:163196557-163196579 TCTAGGAATTTCATGGTTTCAGG + Intergenic
941453069 2:165682752-165682774 TGTAGCACTTTCCTGGCATGTGG - Exonic
943203508 2:184860582-184860604 TCTGGGCCTTTCTTAGCACCAGG - Intronic
945179804 2:207080199-207080221 TCCAGGACTCTCTCGGCACCTGG - Exonic
945209354 2:207366332-207366354 TCTGGGAGTTCCTTGGCTTCTGG - Intergenic
946465811 2:219910993-219911015 TCTGGGACCTTCTTGGGATAGGG - Intergenic
1168865000 20:1078728-1078750 CCTAGGGCTTCCTTGGCCTCTGG + Intergenic
1177179269 21:17727262-17727284 TCTTTGACTTTCTTTCCATCAGG + Intergenic
1177869274 21:26550928-26550950 TCTAGGACTTTCATAGCTACAGG + Intronic
1182026504 22:27123346-27123368 TTTAGCACTTTCTCTGCATCGGG - Intergenic
1184594434 22:45505238-45505260 TCCAAGGCTTTCTTGGCCTCTGG + Intronic
1185092206 22:48782001-48782023 TGCAGGCCTTTCTTGGCATGTGG - Intronic
1185211891 22:49575210-49575232 TCAAGGACTGTCATGGGATCAGG + Intronic
952684469 3:36132534-36132556 TCTAGCCCTTTCTTAGCTTCTGG - Intergenic
952982275 3:38746593-38746615 TCTAGGAGTTTCTTGGGATCTGG + Intronic
954001010 3:47557034-47557056 TCTAGGACTAGCTAGGCATCAGG - Intergenic
956175919 3:66472850-66472872 TCTAGGACTTTCCTAGGACCAGG + Intronic
956699561 3:71947223-71947245 TCTATCCCATTCTTGGCATCAGG + Intergenic
958639161 3:96782004-96782026 TCTAGGACTTTCATAGGTTCAGG - Intergenic
958774932 3:98470767-98470789 TCTTGGTCTGTGTTGGCATCAGG + Intergenic
960849137 3:122034354-122034376 TCCAGGATTTTCTTGTCATATGG - Intergenic
961852053 3:129830251-129830273 TCAATGACTGTCTTGGCCTCTGG + Intronic
962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG + Intronic
962703990 3:138026104-138026126 CCAAGGTCTTTCTTGGCAGCTGG - Intronic
962724519 3:138209862-138209884 TGTAGAACTTTCTGGGGATCAGG - Exonic
964929425 3:161998531-161998553 TCTAGGAGTTTCATGGTTTCAGG + Intergenic
965099094 3:164273939-164273961 TCTAGGGCTATCCTGGCATAGGG - Intergenic
966688618 3:182722454-182722476 TCTAGCCCTTTCCTGGCTTCTGG + Intergenic
966940273 3:184741633-184741655 TGCAGAACTTTCCTGGCATCGGG - Intergenic
967804769 3:193705724-193705746 TCTTTGCCTTTTTTGGCATCTGG + Intergenic
969286524 4:6205790-6205812 TCCAGGACTTCCTTGGCTTGCGG + Intergenic
969507261 4:7595819-7595841 TCAAGCACTTTCTAGGCACCAGG + Intronic
971590732 4:28466108-28466130 TCTAGGAGTTTTAGGGCATCGGG - Intergenic
973729299 4:53808213-53808235 TCTAGGACTTTTATGATATCAGG + Intronic
974926624 4:68306936-68306958 TCTAGGAGTTTTATGGCTTCAGG + Intergenic
976935982 4:90633524-90633546 TCTAGGCCTTTCTTCTAATCTGG - Intronic
977536210 4:98259644-98259666 TCTGGTAGTTTCTTGGCATATGG - Intergenic
977748482 4:100579985-100580007 TCTAGGACTTTCCAGGCTCCAGG + Intronic
977964081 4:103122947-103122969 TTGAAGACTTCCTTGGCATCTGG - Exonic
978069877 4:104454051-104454073 TCCAGTTCTTTTTTGGCATCTGG + Intergenic
979977729 4:127217959-127217981 TCTAGGCATTTCTTAGCTTCAGG - Intergenic
981525563 4:145703712-145703734 TCTAGGAGTTTCTTGTTTTCAGG + Intronic
981881497 4:149618381-149618403 TCTAGGATTTTTATGGCTTCAGG - Intergenic
982279711 4:153670449-153670471 TCTAGAACTTTCATAGCTTCAGG + Intergenic
983576140 4:169263831-169263853 TCCAGAACTTTCTGTGCATCTGG + Intronic
987117238 5:14735642-14735664 TCCAGGCCTTTCCTGGCTTCTGG + Intronic
990260815 5:54020452-54020474 ACTAAGTCTTTGTTGGCATCTGG - Intronic
995888432 5:116922058-116922080 TCCAGGCCTTTCTTGGCTTGTGG - Intergenic
997577190 5:134989353-134989375 TCTAGGACTTTCATAGCTACAGG - Intronic
998188095 5:139998370-139998392 TCCAGGACTTTCTTGGCCTTGGG - Intronic
998910126 5:146950715-146950737 ACTTGGTCTGTCTTGGCATCTGG - Intronic
999589152 5:153124709-153124731 TCTATGACTTTCTTGCTTTCTGG - Intergenic
1003163855 6:3659436-3659458 TCCAGGACTATGTTGGGATCAGG + Intergenic
1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG + Intergenic
1005337079 6:24808030-24808052 TCTAAGTGTTCCTTGGCATCAGG - Intronic
1009686048 6:66959159-66959181 TTTAGGATTGTCTTGGCATCAGG - Intergenic
1010471433 6:76233084-76233106 TCTTGAACTTTCATGGCCTCAGG + Intergenic
1011014359 6:82738307-82738329 TCTAGTTCTTTCTTAGGATCAGG - Intergenic
1011165683 6:84443322-84443344 TATAGTACTTTCTATGCATCAGG - Intergenic
1011387821 6:86816269-86816291 GCTAGTACTTTCATGGCTTCAGG - Intergenic
1011741682 6:90367603-90367625 TCTAGGAGTTTTATGGTATCAGG + Intergenic
1012302500 6:97606661-97606683 TCCAGGAATTCCTTGGCTTCCGG + Intergenic
1012502736 6:99907412-99907434 TCTAGTAGTTTCATGGCTTCGGG - Intergenic
1013562069 6:111315625-111315647 TCCAGGACTTTCTTGACTACTGG - Intronic
1016872867 6:148836398-148836420 CATAGGACCTACTTGGCATCTGG + Intronic
1019100376 6:169625013-169625035 TCTAGGCTTCACTTGGCATCTGG + Intronic
1019685946 7:2382275-2382297 TCCATCTCTTTCTTGGCATCCGG - Intergenic
1020809196 7:12830550-12830572 TCTGGGACTTTCTTGAGAGCAGG + Intergenic
1021901869 7:25293450-25293472 TCTTGTACTTTCTGGGCCTCTGG + Intergenic
1024521741 7:50310722-50310744 TCTAGAACTTTCTTGCTAACAGG + Intronic
1027667772 7:81060197-81060219 ATTATGAATTTCTTGGCATCAGG - Intergenic
1028251522 7:88544251-88544273 TCTAGCCCTTTCTTAGCCTCTGG + Intergenic
1031066224 7:117108201-117108223 TCTAGAACTTTTATGGTATCAGG + Intronic
1031301093 7:120061369-120061391 TCCAGGACTTTCCTGACACCTGG + Intergenic
1033454544 7:141490814-141490836 TAAAGGGCTTTCTTGGCATGAGG - Intergenic
1033781795 7:144680023-144680045 TCTTGGACTTTCTGGGCTGCAGG + Intronic
1035923926 8:3707472-3707494 TCTAGGACTTTCTACCCATTGGG - Intronic
1036489820 8:9214575-9214597 TCTACTAGTTTCTTGGCTTCTGG - Intergenic
1036932322 8:12968261-12968283 TATATGACTTTCTGGGCATGTGG + Intronic
1037069211 8:14622328-14622350 TCTATGAGTTTCTTGGGGTCAGG + Intronic
1039281833 8:35994607-35994629 TCTAGGATTTTCATGGTTTCAGG + Intergenic
1039643055 8:39244885-39244907 TCTAGGATTTTTATGGCTTCAGG - Intronic
1042325603 8:67524472-67524494 TCTAGGCATTCCTTGGCATGTGG + Intronic
1042765358 8:72315393-72315415 ACTGGGACTTTCTTGGAAGCTGG - Intergenic
1043106947 8:76125752-76125774 ACTAGGACTTTCCTGAGATCTGG - Intergenic
1044947483 8:97403479-97403501 TCTAGAATTTTCATGGCTTCAGG + Intergenic
1046078388 8:109339118-109339140 TCTAGGCCTTTCATTTCATCTGG - Intronic
1048642454 8:136379456-136379478 TCTAGAACTTTCATGGTTTCGGG + Intergenic
1050294490 9:4191518-4191540 TCTAGGTCTTTCTTGGTAATAGG - Intronic
1057083064 9:92187277-92187299 TCAAGGACTTTCCTGGCACTAGG - Intergenic
1060752476 9:126182512-126182534 TCTAGGCCTTTCCTGCTATCTGG - Intergenic
1062203718 9:135322999-135323021 CCTAGGTCATTCTTAGCATCAGG + Intergenic
1062339353 9:136087124-136087146 CCTGGGCCTTTCTTGGCATGTGG - Intronic
1186949282 X:14605033-14605055 TCAAAGACTTTAGTGGCATCAGG - Intronic
1188427150 X:30062166-30062188 TCTTGGACTTCCTTAGGATCGGG - Intergenic
1191165449 X:57385427-57385449 TCTTGGACTTTCCTGTCTTCAGG - Intronic
1192475135 X:71434695-71434717 TCTAGTACTTACGTGGCAGCTGG - Intronic
1193365355 X:80625031-80625053 TCTTGGACTTTGTTATCATCTGG - Intergenic
1194075359 X:89385380-89385402 TCTAGAACTTTTATGGCTTCAGG + Intergenic
1195757961 X:108218033-108218055 TCTAGGGCTCTCTTGGCCACAGG + Intronic
1199026352 X:142943077-142943099 TCTTGGACTTTCTAGCCTTCAGG + Intergenic
1199853878 X:151744193-151744215 TCTAGGACTTTCTTGGCATCAGG - Exonic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200730958 Y:6739540-6739562 TCTAGAACTTTTATGGCTTCAGG + Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic