ID: 1199856825

View in Genome Browser
Species Human (GRCh38)
Location X:151766058-151766080
Sequence CAGGGGACAGACTTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199856825_1199856828 -9 Left 1199856825 X:151766058-151766080 CCCTCCTCAAAGTCTGTCCCCTG No data
Right 1199856828 X:151766072-151766094 TGTCCCCTGCACAGCTGCCAAGG No data
1199856825_1199856830 -7 Left 1199856825 X:151766058-151766080 CCCTCCTCAAAGTCTGTCCCCTG No data
Right 1199856830 X:151766074-151766096 TCCCCTGCACAGCTGCCAAGGGG No data
1199856825_1199856829 -8 Left 1199856825 X:151766058-151766080 CCCTCCTCAAAGTCTGTCCCCTG No data
Right 1199856829 X:151766073-151766095 GTCCCCTGCACAGCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199856825 Original CRISPR CAGGGGACAGACTTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr