ID: 1199861238

View in Genome Browser
Species Human (GRCh38)
Location X:151801776-151801798
Sequence GGCTGCACACTGTGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199861238_1199861252 30 Left 1199861238 X:151801776-151801798 CCAGCTCCACACAGTGTGCAGCC No data
Right 1199861252 X:151801829-151801851 GATGGCAGCGGCAGGCCATCTGG No data
1199861238_1199861250 22 Left 1199861238 X:151801776-151801798 CCAGCTCCACACAGTGTGCAGCC No data
Right 1199861250 X:151801821-151801843 GCCAGCGTGATGGCAGCGGCAGG No data
1199861238_1199861249 18 Left 1199861238 X:151801776-151801798 CCAGCTCCACACAGTGTGCAGCC No data
Right 1199861249 X:151801817-151801839 TGCAGCCAGCGTGATGGCAGCGG 0: 4
1: 21
2: 57
3: 95
4: 339
1199861238_1199861247 12 Left 1199861238 X:151801776-151801798 CCAGCTCCACACAGTGTGCAGCC No data
Right 1199861247 X:151801811-151801833 CCCTGCTGCAGCCAGCGTGATGG 0: 7
1: 42
2: 68
3: 125
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199861238 Original CRISPR GGCTGCACACTGTGTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr