ID: 1199862041

View in Genome Browser
Species Human (GRCh38)
Location X:151809878-151809900
Sequence GCCTTTGACTGCAGCTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199862041_1199862048 18 Left 1199862041 X:151809878-151809900 CCTCAGAAGCTGCAGTCAAAGGC No data
Right 1199862048 X:151809919-151809941 GTTCCTCAACTCTGGTTTCTGGG No data
1199862041_1199862046 10 Left 1199862041 X:151809878-151809900 CCTCAGAAGCTGCAGTCAAAGGC No data
Right 1199862046 X:151809911-151809933 CTAGATAGGTTCCTCAACTCTGG No data
1199862041_1199862047 17 Left 1199862041 X:151809878-151809900 CCTCAGAAGCTGCAGTCAAAGGC No data
Right 1199862047 X:151809918-151809940 GGTTCCTCAACTCTGGTTTCTGG No data
1199862041_1199862053 29 Left 1199862041 X:151809878-151809900 CCTCAGAAGCTGCAGTCAAAGGC No data
Right 1199862053 X:151809930-151809952 CTGGTTTCTGGGCAGGGTCTGGG No data
1199862041_1199862042 -4 Left 1199862041 X:151809878-151809900 CCTCAGAAGCTGCAGTCAAAGGC No data
Right 1199862042 X:151809897-151809919 AGGCCTCATATGCCCTAGATAGG No data
1199862041_1199862051 23 Left 1199862041 X:151809878-151809900 CCTCAGAAGCTGCAGTCAAAGGC No data
Right 1199862051 X:151809924-151809946 TCAACTCTGGTTTCTGGGCAGGG No data
1199862041_1199862052 28 Left 1199862041 X:151809878-151809900 CCTCAGAAGCTGCAGTCAAAGGC No data
Right 1199862052 X:151809929-151809951 TCTGGTTTCTGGGCAGGGTCTGG No data
1199862041_1199862050 22 Left 1199862041 X:151809878-151809900 CCTCAGAAGCTGCAGTCAAAGGC No data
Right 1199862050 X:151809923-151809945 CTCAACTCTGGTTTCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199862041 Original CRISPR GCCTTTGACTGCAGCTTCTG AGG (reversed) Intergenic
No off target data available for this crispr