ID: 1199864111

View in Genome Browser
Species Human (GRCh38)
Location X:151827636-151827658
Sequence CTGTGGGCCTGGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199864111_1199864121 11 Left 1199864111 X:151827636-151827658 CCTCCTTCCTTCCAGGCCCACAG No data
Right 1199864121 X:151827670-151827692 CCTCTTCCCATAGGACTCTCAGG No data
1199864111_1199864117 2 Left 1199864111 X:151827636-151827658 CCTCCTTCCTTCCAGGCCCACAG No data
Right 1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG No data
1199864111_1199864122 12 Left 1199864111 X:151827636-151827658 CCTCCTTCCTTCCAGGCCCACAG No data
Right 1199864122 X:151827671-151827693 CTCTTCCCATAGGACTCTCAGGG No data
1199864111_1199864125 23 Left 1199864111 X:151827636-151827658 CCTCCTTCCTTCCAGGCCCACAG No data
Right 1199864125 X:151827682-151827704 GGACTCTCAGGGTGTTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199864111 Original CRISPR CTGTGGGCCTGGAAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr