ID: 1199864117

View in Genome Browser
Species Human (GRCh38)
Location X:151827661-151827683
Sequence CGTGCCCTGCCTCTTCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199864113_1199864117 -5 Left 1199864113 X:151827643-151827665 CCTTCCAGGCCCACAGCACGTGC No data
Right 1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG No data
1199864111_1199864117 2 Left 1199864111 X:151827636-151827658 CCTCCTTCCTTCCAGGCCCACAG No data
Right 1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG No data
1199864110_1199864117 5 Left 1199864110 X:151827633-151827655 CCTCCTCCTTCCTTCCAGGCCCA No data
Right 1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG No data
1199864112_1199864117 -1 Left 1199864112 X:151827639-151827661 CCTTCCTTCCAGGCCCACAGCAC No data
Right 1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG No data
1199864108_1199864117 28 Left 1199864108 X:151827610-151827632 CCTCTGGCAACATTATTGTGTCG No data
Right 1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG No data
1199864114_1199864117 -9 Left 1199864114 X:151827647-151827669 CCAGGCCCACAGCACGTGCCCTG No data
Right 1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199864117 Original CRISPR CGTGCCCTGCCTCTTCCCAT AGG Intergenic
No off target data available for this crispr