ID: 1199867480

View in Genome Browser
Species Human (GRCh38)
Location X:151865545-151865567
Sequence ATCTGATGCTAAAATTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199867480_1199867482 19 Left 1199867480 X:151865545-151865567 CCATATTAATTTTAGCATCAGAT No data
Right 1199867482 X:151865587-151865609 CGTGTTTTGTGATTTTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199867480 Original CRISPR ATCTGATGCTAAAATTAATA TGG (reversed) Intergenic
No off target data available for this crispr