ID: 1199868459

View in Genome Browser
Species Human (GRCh38)
Location X:151875323-151875345
Sequence CTGCTGTTCTTGGGCAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199868459_1199868467 7 Left 1199868459 X:151875323-151875345 CCTTGCTTGCCCAAGAACAGCAG No data
Right 1199868467 X:151875353-151875375 CTTAGTAGGCCTACAGAGGTTGG No data
1199868459_1199868471 23 Left 1199868459 X:151875323-151875345 CCTTGCTTGCCCAAGAACAGCAG No data
Right 1199868471 X:151875369-151875391 AGGTTGGAGGAGAAGAAACAGGG No data
1199868459_1199868462 -7 Left 1199868459 X:151875323-151875345 CCTTGCTTGCCCAAGAACAGCAG No data
Right 1199868462 X:151875339-151875361 ACAGCAGCCCAATCCTTAGTAGG No data
1199868459_1199868470 22 Left 1199868459 X:151875323-151875345 CCTTGCTTGCCCAAGAACAGCAG No data
Right 1199868470 X:151875368-151875390 GAGGTTGGAGGAGAAGAAACAGG No data
1199868459_1199868465 3 Left 1199868459 X:151875323-151875345 CCTTGCTTGCCCAAGAACAGCAG No data
Right 1199868465 X:151875349-151875371 AATCCTTAGTAGGCCTACAGAGG No data
1199868459_1199868468 10 Left 1199868459 X:151875323-151875345 CCTTGCTTGCCCAAGAACAGCAG No data
Right 1199868468 X:151875356-151875378 AGTAGGCCTACAGAGGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199868459 Original CRISPR CTGCTGTTCTTGGGCAAGCA AGG (reversed) Intergenic
No off target data available for this crispr