ID: 1199877577

View in Genome Browser
Species Human (GRCh38)
Location X:151946586-151946608
Sequence AGAGGTAGCCTGCACACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199877577_1199877581 5 Left 1199877577 X:151946586-151946608 CCTCCAGTGTGCAGGCTACCTCT No data
Right 1199877581 X:151946614-151946636 GTCCTGTCCAATCAGAATGATGG No data
1199877577_1199877585 13 Left 1199877577 X:151946586-151946608 CCTCCAGTGTGCAGGCTACCTCT No data
Right 1199877585 X:151946622-151946644 CAATCAGAATGATGGTGTCAGGG No data
1199877577_1199877584 12 Left 1199877577 X:151946586-151946608 CCTCCAGTGTGCAGGCTACCTCT No data
Right 1199877584 X:151946621-151946643 CCAATCAGAATGATGGTGTCAGG No data
1199877577_1199877586 19 Left 1199877577 X:151946586-151946608 CCTCCAGTGTGCAGGCTACCTCT No data
Right 1199877586 X:151946628-151946650 GAATGATGGTGTCAGGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199877577 Original CRISPR AGAGGTAGCCTGCACACTGG AGG (reversed) Intergenic
No off target data available for this crispr