ID: 1199880958

View in Genome Browser
Species Human (GRCh38)
Location X:151974199-151974221
Sequence CTGCCCTGGCCGGTCACCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 280}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199880946_1199880958 3 Left 1199880946 X:151974173-151974195 CCTCCGGCCCCCCCAGTAGCTGA 0: 1
1: 0
2: 6
3: 74
4: 1474
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880945_1199880958 18 Left 1199880945 X:151974158-151974180 CCTTCTCAAAATGCACCTCCGGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880939_1199880958 29 Left 1199880939 X:151974147-151974169 CCCGCGCACCCCCTTCTCAAAAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880948_1199880958 -4 Left 1199880948 X:151974180-151974202 CCCCCCCAGTAGCTGAAGCCTGC 0: 1
1: 0
2: 3
3: 162
4: 653
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880951_1199880958 -7 Left 1199880951 X:151974183-151974205 CCCCAGTAGCTGAAGCCTGCCCT 0: 1
1: 0
2: 1
3: 13
4: 265
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880943_1199880958 19 Left 1199880943 X:151974157-151974179 CCCTTCTCAAAATGCACCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880947_1199880958 0 Left 1199880947 X:151974176-151974198 CCGGCCCCCCCAGTAGCTGAAGC 0: 1
1: 0
2: 4
3: 53
4: 744
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880940_1199880958 28 Left 1199880940 X:151974148-151974170 CCGCGCACCCCCTTCTCAAAATG 0: 1
1: 0
2: 0
3: 26
4: 158
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880949_1199880958 -5 Left 1199880949 X:151974181-151974203 CCCCCCAGTAGCTGAAGCCTGCC 0: 1
1: 0
2: 1
3: 19
4: 231
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880952_1199880958 -8 Left 1199880952 X:151974184-151974206 CCCAGTAGCTGAAGCCTGCCCTG 0: 1
1: 0
2: 0
3: 22
4: 288
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880941_1199880958 21 Left 1199880941 X:151974155-151974177 CCCCCTTCTCAAAATGCACCTCC 0: 1
1: 0
2: 3
3: 17
4: 284
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880953_1199880958 -9 Left 1199880953 X:151974185-151974207 CCAGTAGCTGAAGCCTGCCCTGG 0: 1
1: 0
2: 1
3: 20
4: 246
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880942_1199880958 20 Left 1199880942 X:151974156-151974178 CCCCTTCTCAAAATGCACCTCCG 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280
1199880950_1199880958 -6 Left 1199880950 X:151974182-151974204 CCCCCAGTAGCTGAAGCCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG 0: 1
1: 0
2: 7
3: 36
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199880958 Original CRISPR CTGCCCTGGCCGGTCACCCC GGG Intronic
900093337 1:930030-930052 CTGCCCTGGTCTCGCACCCCAGG - Intronic
900180096 1:1307557-1307579 CTGCCCTGTGCGGCCGCCCCGGG - Intronic
900498341 1:2987107-2987129 CTGGCTTGGCGGGTCACCCCTGG - Intergenic
900530243 1:3149465-3149487 CTGCCCTGCCCTGCCACTCCTGG + Intronic
900592967 1:3468015-3468037 CTGCCCTGGCCGGGGTCCCAGGG - Intronic
901026437 1:6280940-6280962 CTGCCGTGACCGGTGACCTCGGG - Intronic
901644039 1:10707062-10707084 GAGTCCTGGCCGGTCAGCCCAGG + Intronic
902664868 1:17930433-17930455 CTCCACTTCCCGGTCACCCCTGG + Intergenic
903799288 1:25954681-25954703 CTGTCCTGCCAGCTCACCCCTGG - Intergenic
904492687 1:30870540-30870562 CTGCCCTGGCCGGCCTGACCGGG - Intronic
905390909 1:37634803-37634825 CTACTCTGGCCGGTCGCTCCGGG + Exonic
906650599 1:47509725-47509747 CCACCCTGGCTGGTCACTCCTGG + Intergenic
909904050 1:81174810-81174832 CTGCCCTGCCCCATCATCCCAGG - Intergenic
912395012 1:109335677-109335699 CTGCCAAGGCCTGTCACTCCAGG + Intronic
914490842 1:148149261-148149283 CTGCACTCGCCGCTCACCTCGGG + Intronic
915199990 1:154220448-154220470 CTGTCCTGGCTGGTCAGCCCAGG + Exonic
915316193 1:155030374-155030396 CAGCCCTGGCCCTGCACCCCCGG + Intronic
915978215 1:160404345-160404367 CTTCCCTGGCACCTCACCCCAGG - Intronic
919763879 1:201114438-201114460 CTCCCCAGGACGGTCATCCCTGG - Exonic
923148871 1:231216707-231216729 CTGCCCTGGCAGGTCAGACTCGG - Exonic
924582610 1:245335320-245335342 CTCCCCTGGCCTGGCATCCCAGG + Intronic
1062848681 10:727026-727048 CTTCGCTGGACGGTCACCCGGGG + Intergenic
1063138104 10:3234728-3234750 CTTCACCGGCAGGTCACCCCTGG + Intergenic
1063426810 10:5956712-5956734 CGTCCCTGCCCCGTCACCCCAGG - Intronic
1064561696 10:16600266-16600288 CTGCCCTGAGCTGCCACCCCAGG + Intronic
1065020230 10:21496597-21496619 CTGCCCGGGCCGTGCACCCGTGG - Intronic
1065101474 10:22336060-22336082 CTGCTCTGCCCGGTCCCCACCGG + Intergenic
1065918904 10:30374096-30374118 CTGCCCTCAGCAGTCACCCCTGG - Intronic
1067429878 10:46236031-46236053 CTGGCCTGGCAGGAGACCCCTGG - Intergenic
1067443762 10:46327788-46327810 CTGGCCTGGCAGGAGACCCCTGG + Intronic
1069981350 10:72255089-72255111 ATGCCCTGGCCTCTCACCCCAGG + Intergenic
1070556639 10:77533140-77533162 ATGCCCTGGATGGTCAGCCCTGG - Intronic
1072003592 10:91220925-91220947 CTGCCCTGGCCGGCCCAGCCTGG + Intronic
1072680161 10:97499967-97499989 CTGCCCTGGCATTTCGCCCCGGG + Intronic
1072926505 10:99621057-99621079 CGGCCTGGGCCGGTCATCCCTGG + Intergenic
1076663243 10:132069249-132069271 CTCCCCTGGCCTCCCACCCCTGG - Intergenic
1076717031 10:132371342-132371364 CTGCCCTGACCCGTCCACCCTGG - Intronic
1076858795 10:133129936-133129958 CGGCCCTGCCCGGCCACACCAGG - Exonic
1077364630 11:2156526-2156548 CTGCCCCTGCCGGGCACTCCCGG - Intronic
1077377466 11:2211786-2211808 ATGCCCTGGCCGGTCCACGCAGG + Intergenic
1077488562 11:2850183-2850205 CAGCCCCGGCCGCCCACCCCGGG + Intergenic
1082987623 11:59182041-59182063 CAGTCCTGGCCAGTCAGCCCTGG + Exonic
1083681492 11:64353866-64353888 CTGCCCTGGCCTCTGACCCCAGG + Intronic
1085281478 11:75333932-75333954 CTGCCCTGGCAGCTCCCCTCAGG + Intronic
1090395213 11:126414257-126414279 CTGCCCTGGCCGGGCTCCCACGG - Exonic
1090732383 11:129583039-129583061 CTGGGCTGGCTGGCCACCCCTGG + Intergenic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1091975268 12:4819562-4819584 CTGCCCTTGTGGGTCTCCCCTGG + Intronic
1094556426 12:31504733-31504755 CTGCCCTGACAGATAACCCCAGG + Intronic
1095669928 12:44847107-44847129 CTGTCCTGGCCTGTCAGCCTTGG - Intronic
1096466171 12:51848621-51848643 CAGCCCAGGCCTGTCGCCCCCGG - Intergenic
1100885661 12:99067068-99067090 GTGCCCTGGCCAGTCTCCCATGG + Intronic
1102424168 12:112827746-112827768 CTCCCCTGGCCCCCCACCCCAGG - Intronic
1103158266 12:118706221-118706243 CTGCTCTGCCCTGGCACCCCTGG + Intergenic
1104836977 12:131797879-131797901 CTGCCCTCTCTGGTCCCCCCAGG - Intronic
1105356685 13:19665407-19665429 CTGCCCTCGCCTGTCACTGCAGG + Intronic
1105593406 13:21814374-21814396 CTGCCCTCGCTGGGCACCCATGG - Intergenic
1107009016 13:35649130-35649152 CTTCCCTGGCAGTTCTCCCCAGG - Intronic
1107630632 13:42339217-42339239 ATGCCATGGCCGGTCACCAAAGG - Intergenic
1112579324 13:100664643-100664665 CTGCACGTGCGGGTCACCCCTGG + Intronic
1112611683 13:100961204-100961226 CTGCCCTGGCTGCACACCCAGGG + Intergenic
1113047697 13:106173571-106173593 CTGCCCTGGCCCATGTCCCCTGG - Intergenic
1113724599 13:112588592-112588614 CCGCGCGGGCCGGTCCCCCCCGG + Intergenic
1115536336 14:34376696-34376718 CAGCCCTGGGTGGTCAGCCCTGG - Intronic
1120275650 14:82369914-82369936 CTGCCCTGTCAGGTGTCCCCTGG - Intergenic
1121105044 14:91274051-91274073 CTTCCTTCCCCGGTCACCCCGGG + Intronic
1123449069 15:20349212-20349234 GTGCCCTTGCCTGTCACCACAGG + Intergenic
1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123645957 15:22437648-22437670 CTGCCCTCACCAATCACCCCAGG - Intergenic
1123667266 15:22617502-22617524 TTGCCCTCGCCAATCACCCCAGG - Intergenic
1123682924 15:22775624-22775646 CTGCCCTCACCAGTCACCCCAGG - Intronic
1123682961 15:22775773-22775795 CTGCCCTCACCGGTCACCCCAGG - Intronic
1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG + Intronic
1123762946 15:23446746-23446768 CTGCCCTCACCAGTCGCCCCAGG - Intronic
1123762986 15:23446893-23446915 CGGCCCTTGCCAGTGACCCCAGG - Intronic
1124282854 15:28378994-28379016 CTGCCCTCACCAATCACCCCAGG + Intronic
1124299845 15:28532619-28532641 CTGCCCTCACCAATCACCCCAGG - Intronic
1124321107 15:28712069-28712091 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124334670 15:28848147-28848169 CTGCCCTCACCAGTCACCCCAGG - Intergenic
1124334708 15:28848296-28848318 CTGCCCTCACCGGTCACCCCAGG - Intergenic
1124481391 15:30083286-30083308 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124487846 15:30135382-30135404 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124522203 15:30413908-30413930 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124536462 15:30552310-30552332 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124542935 15:30604359-30604381 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124562936 15:30791943-30791965 CCGCCCTCGCCAGTCATCCCTGG + Intergenic
1124755683 15:32402939-32402961 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124762189 15:32455282-32455304 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124776440 15:32593786-32593808 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124960419 15:34389436-34389458 CTGCCCTCGCCGATCACCCCGGG - Intronic
1124972059 15:34496897-34496919 GGGCCCTGGCGGCTCACCCCAGG - Intergenic
1124977048 15:34535657-34535679 CTGCCCTCGCCGATCACCCCGGG - Intronic
1125834377 15:42736862-42736884 CTGCCCGGGCCGCCCACCCGAGG - Intronic
1127285303 15:57527573-57527595 CTGAGCTGGCTGGTCTCCCCAGG + Intronic
1129029062 15:72605441-72605463 CTGCCCTCAACAGTCACCCCAGG + Intergenic
1129263294 15:74380952-74380974 CTGCCCCTGCCCCTCACCCCAGG + Intergenic
1129664823 15:77573695-77573717 CTGCCCTGGACTGCCAGCCCAGG - Intergenic
1129799834 15:78405670-78405692 CTGCCCTGGATGCTCACCCGGGG + Intergenic
1129838269 15:78727447-78727469 CTGCCCTCACCAATCACCCCAGG + Intronic
1130260263 15:82348931-82348953 CTGCCCTCACCAGTCATCCCTGG - Intronic
1130260314 15:82349086-82349108 CTGCCCTTGCCAATCACCCCAGG - Intronic
1130268416 15:82430347-82430369 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130268467 15:82430502-82430524 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130280970 15:82520076-82520098 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130339438 15:82986636-82986658 CTGCCCTGGGAGGTGAGCCCGGG - Intronic
1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130472340 15:84236257-84236279 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130479831 15:84350828-84350850 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130491939 15:84437301-84437323 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130491988 15:84437456-84437478 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130503553 15:84516341-84516363 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130503604 15:84516496-84516518 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130594638 15:85240893-85240915 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1131269013 15:90935352-90935374 GAGCCCCGGCCGGCCACCCCCGG + Exonic
1131936681 15:97513724-97513746 CTCCCCTGGCCCCCCACCCCTGG - Intergenic
1132499927 16:280748-280770 CTGCCCGGCCCGCTCACCTCGGG - Exonic
1132762947 16:1519844-1519866 CTGCCCTGGCCTGTCCCCGCTGG + Intronic
1132906808 16:2286648-2286670 CTGCCCTGGCCAGAGCCCCCAGG - Intronic
1133042321 16:3067190-3067212 CAGCCCTGGCCGGTCTTTCCAGG + Intronic
1133386801 16:5376495-5376517 CTGCCCTGTCTGCTCATCCCTGG - Intergenic
1135550894 16:23397481-23397503 CTGCCCTCCCCATTCACCCCTGG - Intronic
1136374752 16:29858935-29858957 CTGCCCGGTCCCGGCACCCCAGG + Exonic
1137571724 16:49570804-49570826 CTGCCCTGGCCTCTGGCCCCTGG - Intronic
1137578969 16:49621890-49621912 CTGCCCTGTTCACTCACCCCAGG + Intronic
1139335296 16:66226972-66226994 CTGACCTGGGCTGTCACCCAGGG + Intergenic
1142283303 16:89160558-89160580 GTGCCCTCGCGGGTCACCCAGGG - Intergenic
1142321650 16:89387018-89387040 CAGCCCTGGCCTGTCACCACGGG - Intronic
1145191424 17:20843857-20843879 CTGCACTCGCCGCTCACCTCGGG + Intronic
1145249999 17:21292066-21292088 CTGCCCTGGTGCGTCACCTCAGG + Intronic
1148559486 17:48597681-48597703 CTCCCCTGGGCGCCCACCCCGGG - Intronic
1148738804 17:49880453-49880475 CTGCCATAGCCGGGGACCCCAGG - Intergenic
1149318227 17:55458731-55458753 CTGCCCTGGCCAGACTGCCCTGG - Intergenic
1151541715 17:74768013-74768035 ATGCCCTGGCCACCCACCCCTGG - Intronic
1151662467 17:75525911-75525933 CCGCCCTGGCCCGACAGCCCAGG - Intronic
1151713640 17:75820458-75820480 CTGTTCTGCCCAGTCACCCCAGG + Intronic
1152099892 17:78294827-78294849 CAGCCCTGGCTGGTGACCCCTGG + Intergenic
1152136404 17:78506550-78506572 CTGCCATGGCTGGGGACCCCAGG + Intronic
1152325108 17:79631533-79631555 CAGCCCTGGCCGGTCCCTCATGG - Intergenic
1152339575 17:79716652-79716674 GTGCCCTTGCCTGTCACCACAGG - Intergenic
1152353408 17:79795468-79795490 CTACCCTGGCCGCTCGCCCCAGG - Exonic
1157569096 18:48700406-48700428 CTGCCCTGGTAGGTCACAGCTGG - Intronic
1157580612 18:48771870-48771892 CTGCCCTGCCCGGGCACGGCCGG + Intronic
1160734957 19:658229-658251 CTGCCCTGCCAGGTCCCACCCGG - Intronic
1160811956 19:1016689-1016711 CTGCCCTGGCCCCTCCCTCCTGG - Intronic
1160994777 19:1877565-1877587 CTGCACTCGCCGCTCACCTCGGG - Exonic
1161029626 19:2051588-2051610 CTCCCTTGGCCTGTCAACCCAGG + Intergenic
1161105381 19:2441252-2441274 CTGCCCTGGCGGGACACAACCGG - Intronic
1161112322 19:2477265-2477287 CTGCCCTGCCCCGCCACGCCCGG + Intronic
1161264700 19:3358903-3358925 CAGCCCTGGCCGGTGACTGCAGG - Intergenic
1161470704 19:4455634-4455656 CTCCCGTGGCCTGTCTCCCCTGG + Intronic
1161722118 19:5908953-5908975 CTGCCGCCGCCGGCCACCCCTGG + Exonic
1162198055 19:9000635-9000657 CTGGCCTGGCCTGTCCCCACAGG + Intergenic
1162386115 19:10361598-10361620 CTGACCTGCCCGGTCCCCACAGG - Exonic
1162727053 19:12696119-12696141 CTGACCTGGGCGGGCGCCCCCGG + Intronic
1162799615 19:13103350-13103372 CTGCCCAGGCTGGACACCCAAGG - Intergenic
1163420707 19:17212177-17212199 CTGCACTGGCAGGTCTGCCCCGG - Exonic
1163761207 19:19137750-19137772 CTGCCCAGGCCGGTCCCGTCAGG + Intronic
1165242599 19:34480703-34480725 CTGCCCTGGGCGGTCTGGCCGGG + Intergenic
1165463380 19:35958060-35958082 CTGCTCTGGCAGGTGACCCCCGG + Intergenic
1166047713 19:40239076-40239098 CTGCCCTGGCTGGGGCCCCCAGG + Intronic
1166746280 19:45143364-45143386 CTGCCTCGGCCTGGCACCCCTGG - Intronic
1167502195 19:49854591-49854613 ATGCCCTGGCCTGTCCCCGCAGG - Intronic
1167829571 19:52008347-52008369 CGGCCATCCCCGGTCACCCCCGG - Intergenic
926062215 2:9811817-9811839 CTGGCCTGGCCGGGAGCCCCCGG - Intergenic
926320617 2:11746466-11746488 CGGCCCTGCCCGCTCACCCCTGG - Intronic
927156476 2:20224249-20224271 CAGCCCTGGCCCGGCTCCCCGGG + Intronic
927531760 2:23811595-23811617 CTCCCCTGGCCTCCCACCCCCGG - Intronic
927810268 2:26176481-26176503 CTGTCCTGGCTGGACACACCTGG - Exonic
927886965 2:26724653-26724675 CTGCCCTGTCCAGGCAGCCCTGG - Intronic
927973731 2:27322470-27322492 GGGCCCTGGCCGCTCACCCGTGG - Exonic
928774879 2:34748936-34748958 CTGCCCAGGCTGGTAACTCCTGG + Intergenic
928774914 2:34749215-34749237 CTGCCCAGGCTGGTAACTCCTGG + Intergenic
931594307 2:63924607-63924629 TTGCCCAGGCTGGTCACTCCTGG - Intronic
931795128 2:65701111-65701133 CTGGCCTGGCCTGTTACCCTTGG + Intergenic
932580453 2:72989891-72989913 CTGCCCCGGCCCGTCAGGCCAGG - Intronic
932739535 2:74281147-74281169 CTGCCCTTCCCGGTCACTGCAGG + Intronic
934789960 2:97050753-97050775 CTCTCCTGGCCTGTCACCTCTGG + Intergenic
936906120 2:117537130-117537152 GTGCCCTGGCTACTCACCCCTGG + Intergenic
937083817 2:119158008-119158030 CTGGCTTGCCCGGTCGCCCCGGG + Exonic
937325846 2:120989218-120989240 CTGCGCTGGCCGTGCAGCCCCGG - Exonic
938251604 2:129820086-129820108 GTGCCCTGGACGGGCAGCCCAGG - Intergenic
938398221 2:130965944-130965966 CTGCCATTGCCGGGCAGCCCTGG - Intronic
939028565 2:137043438-137043460 CTGCTCTGCCTGGTCACCCTAGG + Intronic
940041816 2:149369185-149369207 CTCCCGTGGCCTGTAACCCCGGG - Intronic
941812455 2:169768252-169768274 CAGCCTTGGCCGGGCTCCCCTGG + Intronic
941903417 2:170698830-170698852 GTGCCCTGGACGCACACCCCAGG - Intergenic
942799757 2:179861471-179861493 CTGGCCTGGCCGAGGACCCCGGG + Exonic
942985112 2:182131691-182131713 CTGCCAGGGACAGTCACCCCAGG - Intergenic
942985371 2:182134501-182134523 CTGCCAGGGACAGTCACCCCAGG - Intergenic
946901766 2:224379974-224379996 AAGCCCTGGCCGGTCATTCCAGG - Exonic
947584459 2:231345044-231345066 CTGCAAAGGCCCGTCACCCCCGG + Exonic
947713406 2:232328444-232328466 CTGCCCTGGCAGGCCCACCCTGG + Intronic
948283616 2:236767931-236767953 CTGCACTGGCCATTAACCCCAGG + Intergenic
948582679 2:238998573-238998595 CTGCCCAGGCTGGACTCCCCTGG + Intergenic
948642886 2:239386480-239386502 CTCCCCTGGCCGGCCACCCCGGG - Intronic
948757762 2:240169177-240169199 CTGCCCAGGCAGGTCACCAGCGG - Intergenic
948859279 2:240745106-240745128 CTGCCCTGGCTGAGCACCCCCGG + Intronic
1171173594 20:23035459-23035481 CTGCCCTGCGCCGGCACCCCTGG + Exonic
1172109562 20:32537049-32537071 CTGCCCTGCCCCGCCCCCCCGGG + Intronic
1172181889 20:33008550-33008572 CTGCCCTGGCCGCTGCCCACAGG - Exonic
1172474416 20:35226588-35226610 CTGCCCTCGCAGGTCCCGCCCGG + Intergenic
1174040696 20:47697496-47697518 CTGCCTTGGCTGGAAACCCCGGG + Intronic
1174176572 20:48649266-48649288 CTGCTCACGCCGGACACCCCCGG + Intronic
1174495760 20:50941169-50941191 TTGCCCAGGCTGGTCACTCCTGG - Intronic
1176196160 20:63837082-63837104 CTGCCCTTGCGGGTCAGACCTGG + Intergenic
1178707320 21:34886772-34886794 CTGCCCTCGCGGATCTCCCCCGG + Intronic
1179231082 21:39504371-39504393 CTGCCCTTGCAGGTCACGCTGGG + Intronic
1179578287 21:42321357-42321379 CTGCCCTGGCCTGGCTCCCTGGG + Intergenic
1180088930 21:45524055-45524077 CTGTCCTGAGCGTTCACCCCTGG + Intronic
1180088940 21:45524093-45524115 CCGCCCTGAGCGTTCACCCCTGG + Intronic
1180088950 21:45524131-45524153 CTGCCCTAAGCGTTCACCCCTGG + Intronic
1180088999 21:45524320-45524342 CTGTCCTGAGCGTTCACCCCCGG + Intronic
1180089009 21:45524358-45524380 CTGCCCTGAACGTTCACCCCTGG + Intronic
1180089030 21:45524434-45524456 CTGCCCTAAGCGTTCACCCCTGG + Intronic
1180089079 21:45524623-45524645 CTGTCCTGAGCGTTCACCCCCGG + Intronic
1180089089 21:45524661-45524683 CTGCCCTGAACGTTCACCCCTGG + Intronic
1180089110 21:45524737-45524759 CTGCCCTAAGCGTTCACCCCTGG + Intronic
1180787334 22:18554300-18554322 CTGCCCTACCCGCTCACCGCTGG + Intergenic
1181120833 22:20668098-20668120 CTGCACTCGCCGCTCACCTCGGG - Intergenic
1181169865 22:21002003-21002025 CTGGCCTGTCGGGTCCCCCCCGG + Exonic
1181234405 22:21441005-21441027 CTGCCCTACCCGCTCACCGCTGG - Intronic
1181244243 22:21493826-21493848 CTGCCCTACCCGCTCACCGCTGG + Intergenic
1181534586 22:23534863-23534885 CAGGTCTGGCAGGTCACCCCAGG + Intergenic
1182014193 22:27025471-27025493 CTCCCCTGGCCGGTCACCCAGGG - Intergenic
1182421907 22:30252700-30252722 CTGCCCTGCCCCGTCCCACCTGG + Intergenic
1183061093 22:35336787-35336809 CTGCACTGGGTGGTGACCCCTGG - Intronic
1183303628 22:37070579-37070601 CTGCCATGGCCACTCACCCTCGG + Exonic
1183357536 22:37367622-37367644 CTGCCCTGGCCTCCCACACCCGG - Intergenic
1183705898 22:39474787-39474809 CTGGCCTGGCCTGTTCCCCCAGG + Intronic
952644497 3:35639364-35639386 CTGCTCTGGCCGGAGACCCCGGG - Intronic
952866833 3:37860845-37860867 CTGCCCTCGACGGACTCCCCCGG + Intergenic
952974386 3:38681653-38681675 CTGCCCTGCCCTGTTACCCAGGG - Intergenic
954638348 3:52083769-52083791 CTTCCCAGGCCGGGCAGCCCTGG - Intronic
954996295 3:54885035-54885057 CTTCCCTGGCTGTTCATCCCAGG - Intronic
955050004 3:55401172-55401194 CGGCCATGGCCTGTCACCACAGG + Intergenic
955220872 3:57022261-57022283 CTGCCCTGTCCAGTCACCTGGGG + Intronic
955220918 3:57022699-57022721 CTGCCCTGTCCAGTCACCTGGGG + Intronic
961373754 3:126448958-126448980 CTGCCCCGTCCCGTCTCCCCAGG - Intronic
962398031 3:135034683-135034705 CTGCCTTGGCAGGGCACCCCAGG - Intronic
963827378 3:149970475-149970497 TGGCCCTGGCCGGGCGCCCCCGG - Intronic
967055521 3:185825696-185825718 CTGCCCTCGCCTCTCACCTCCGG - Intergenic
968258099 3:197297704-197297726 CTGCCCTGTCCGGCCCCCGCTGG - Intronic
968897968 4:3415896-3415918 CTGCCAAGGCCCGACACCCCCGG - Intronic
968957877 4:3728323-3728345 CTCCCCCTGCCAGTCACCCCCGG + Intergenic
969259415 4:6024047-6024069 CTGCCTTGGGAGGCCACCCCTGG - Intergenic
970616342 4:17771730-17771752 CTGCCCTGGCCTCTCAGCCCAGG + Intronic
975449827 4:74511318-74511340 CTCCCCTAGCCCCTCACCCCCGG - Intergenic
980937802 4:139242675-139242697 CTGCCCTGCCCTGTGGCCCCCGG - Intergenic
985862826 5:2487741-2487763 CTGCCCAGGCTGGGCACCTCAGG + Intergenic
985917375 5:2932906-2932928 CTGCCTGGGACGGACACCCCAGG - Intergenic
986264695 5:6181645-6181667 CAGCCCTGTCGGGTCAGCCCTGG - Intergenic
986393524 5:7306158-7306180 CTGCCCTCACCAGTCACCCCAGG - Intergenic
986393561 5:7306307-7306329 CTGCCCTCACCGGTCACCCCAGG - Intergenic
993447168 5:88027536-88027558 CTGCCCTGCCTTGCCACCCCAGG + Intergenic
997583720 5:135032972-135032994 CTGCCCGCGCCGGCCACCCGCGG + Intronic
997903897 5:137795032-137795054 CTGCCCTGGCCCCTCCCTCCCGG - Intergenic
998416755 5:141951773-141951795 CTGCTCTGTCATGTCACCCCAGG + Intronic
999828791 5:155299472-155299494 CTGCCCTGGCTGCCCAGCCCTGG + Intergenic
1000879387 5:166679931-166679953 CTGCAATGCCCAGTCACCCCAGG + Intergenic
1002196535 5:177504461-177504483 CTGCCCTCCCTGGACACCCCCGG - Exonic
1006388456 6:33745300-33745322 TTGGCCTGGCCTGTGACCCCCGG + Intronic
1006444853 6:34074410-34074432 CTGCCCTGGCAGGTCCTCCAAGG - Intronic
1006668955 6:35717790-35717812 CTGCCCTGGGAGGTGACCCCAGG - Intronic
1006914895 6:37587862-37587884 CTTCCCTGGCCAGTCACTCCCGG + Intergenic
1007358743 6:41340902-41340924 CTGCCCTGGAAGGTCCTCCCTGG - Intronic
1018550837 6:164997054-164997076 CTGCCCTGGCCCCTCAGCCCCGG + Intergenic
1019361038 7:604312-604334 CGGCACTGGCGGGTCAACCCTGG - Intronic
1019432467 7:1005635-1005657 CTGCTCTGGCCTGTCATTCCAGG + Intronic
1019488796 7:1301518-1301540 CTGCCCTGGCTGTGCACCCACGG + Intergenic
1022028175 7:26467792-26467814 CAGCCCTGGGCGGTCTCCTCTGG + Intergenic
1022452262 7:30525955-30525977 CTGCCCTTGCCAATCTCCCCAGG - Intronic
1022653175 7:32295325-32295347 CTGCCCTGACCCGTCAGCCCGGG - Intronic
1022786836 7:33646387-33646409 CTGGCTTGGCCAGTGACCCCAGG - Intergenic
1033345696 7:140524063-140524085 CTGCCCTGGCCAGAATCCCCTGG - Intronic
1033905406 7:146195693-146195715 CTGGGCTGGCTGGTCACCCTGGG - Intronic
1034201459 7:149285447-149285469 CTGCCCAGGCCGGCCAGCACAGG + Intronic
1034769946 7:153764396-153764418 CTGCACTCGCCGGTCCTCCCTGG + Intergenic
1034977527 7:155457251-155457273 CAGCCCCGCCAGGTCACCCCGGG - Intergenic
1036621534 8:10427475-10427497 CTGCCCTGCCCTGACTCCCCAGG + Intronic
1037561002 8:20074227-20074249 CAGCACAGGCCGGTCACCACAGG + Intergenic
1038229759 8:25689081-25689103 CGGCCCTGGCCGGGATCCCCAGG - Intergenic
1042226449 8:66518733-66518755 CTGGCCTGACCTGTCCCCCCTGG + Intergenic
1043479776 8:80641303-80641325 CTGCCCTGGCCTGCCACTGCAGG - Exonic
1045805399 8:106154951-106154973 CTGCCCAGGCTGGTCTCTCCTGG - Intergenic
1047504275 8:125466529-125466551 CTGCTCTGGCAAATCACCCCTGG - Intergenic
1048976315 8:139674868-139674890 TTCCCCTGGCCTGGCACCCCAGG + Intronic
1049381095 8:142316256-142316278 CTGCCCTGGCCTGTGCCCTCGGG - Intronic
1049556265 8:143283719-143283741 CGGCCCTGGCCCGCCACCCTTGG + Intergenic
1049597040 8:143489496-143489518 CTCCCCTGGCCCCTCTCCCCTGG - Intronic
1049685519 8:143937779-143937801 CTGCTCTGGCCGGGCAGCCGAGG - Intronic
1049855978 8:144862180-144862202 CTGCCCTGGCAGGTGTCCTCAGG + Intergenic
1049988648 9:973188-973210 ATCCCCGGGCCGGTGACCCCGGG + Intergenic
1052706367 9:31998076-31998098 CTGCCCTGGCTGGTTACCAAAGG - Intergenic
1053014644 9:34654874-34654896 CTGCCCTTGGCGCCCACCCCTGG - Intronic
1053055014 9:34988956-34988978 CTGCCCAGGCCGGTGCCTCCAGG - Intergenic
1055583875 9:77735789-77735811 CAGCCCTGGCCTGTCACCACTGG - Intronic
1056385786 9:86095782-86095804 CTGACCTGGCAGGTGACTCCTGG + Intronic
1057141800 9:92731000-92731022 CCACCCTGGCCAGCCACCCCGGG + Intronic
1060588280 9:124800251-124800273 CTCCTCTGGCCAGTCACCCTTGG + Intronic
1061017361 9:127989602-127989624 CTGCCCTGACCACCCACCCCAGG - Intergenic
1061065560 9:128275694-128275716 CCGCCCTCGCCAGTCGCCCCCGG - Intronic
1061798448 9:133101794-133101816 CTGCCCTGTGGGGGCACCCCAGG + Intronic
1061856290 9:133443550-133443572 CTGCCCTGCCAGGTGAGCCCAGG + Exonic
1062109392 9:134773699-134773721 CTGCCCTGGAGGGTCAGTCCTGG - Intronic
1062610620 9:137371763-137371785 ATCCCCTGGCAGGACACCCCCGG + Intronic
1185784420 X:2877967-2877989 CTTCCCTGGACAGTCACCCTTGG + Intronic
1189701610 X:43719347-43719369 CTGCCCCTGCGGGTCACACCAGG - Intronic
1190161912 X:48038205-48038227 CTCCCCTTGCCTCTCACCCCTGG - Intronic
1191690356 X:63932850-63932872 CTGGCCTGGCTGGACACCTCAGG + Intergenic
1192261215 X:69506673-69506695 CGGCTCTGGCCAGTCACCTCAGG - Intronic
1198806656 X:140501374-140501396 CTCCCCTGGCCCCTCAACCCGGG - Intergenic
1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG + Intronic
1200104188 X:153703304-153703326 CTGCCCTGGCCCCTGGCCCCTGG + Intronic
1202366340 Y:24168454-24168476 TTGCCCTTGCCAGTCACCACAGG + Intergenic
1202366392 Y:24168609-24168631 CCGCCCTGGCCAGTCATCCCTGG + Intergenic
1202374116 Y:24218035-24218057 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1202496665 Y:25452085-25452107 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1202504389 Y:25501514-25501536 CCGCCCTGGCCAGTCATACCTGG - Intergenic
1202504441 Y:25501669-25501691 TTGCCCTTGCCAGTCACCACAGG - Intergenic