ID: 1199881563

View in Genome Browser
Species Human (GRCh38)
Location X:151977470-151977492
Sequence GTACAACTGACAGATGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199881559_1199881563 15 Left 1199881559 X:151977432-151977454 CCAGAAGAGGAGCCGCAGGAGGG No data
Right 1199881563 X:151977470-151977492 GTACAACTGACAGATGGAGTTGG No data
1199881561_1199881563 3 Left 1199881561 X:151977444-151977466 CCGCAGGAGGGAGCAACATCTAA No data
Right 1199881563 X:151977470-151977492 GTACAACTGACAGATGGAGTTGG No data
1199881556_1199881563 27 Left 1199881556 X:151977420-151977442 CCACAGGGATGGCCAGAAGAGGA No data
Right 1199881563 X:151977470-151977492 GTACAACTGACAGATGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199881563 Original CRISPR GTACAACTGACAGATGGAGT TGG Intergenic