ID: 1199886730

View in Genome Browser
Species Human (GRCh38)
Location X:152027881-152027903
Sequence CATTTTTGAGAGTGTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199886730_1199886733 3 Left 1199886730 X:152027881-152027903 CCAGGTGCACACTCTCAAAAATG No data
Right 1199886733 X:152027907-152027929 ACTCCTTAGCAAACTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199886730 Original CRISPR CATTTTTGAGAGTGTGCACC TGG (reversed) Intergenic
No off target data available for this crispr