ID: 1199888665

View in Genome Browser
Species Human (GRCh38)
Location X:152051074-152051096
Sequence CTCCATTTACAAATGGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199888665_1199888668 26 Left 1199888665 X:152051074-152051096 CCATTGACCATTTGTAAATGGAG No data
Right 1199888668 X:152051123-152051145 TTTAAGTTCCCTATGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199888665 Original CRISPR CTCCATTTACAAATGGTCAA TGG (reversed) Intergenic