ID: 1199893299

View in Genome Browser
Species Human (GRCh38)
Location X:152109557-152109579
Sequence CCTCTACCCTAGACAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199893292_1199893299 5 Left 1199893292 X:152109529-152109551 CCTTCCCATGTCCAGACATTGGA No data
Right 1199893299 X:152109557-152109579 CCTCTACCCTAGACAGTGTATGG No data
1199893288_1199893299 30 Left 1199893288 X:152109504-152109526 CCATTTCCACGGGGGTTCCATCT No data
Right 1199893299 X:152109557-152109579 CCTCTACCCTAGACAGTGTATGG No data
1199893290_1199893299 13 Left 1199893290 X:152109521-152109543 CCATCTAACCTTCCCATGTCCAG No data
Right 1199893299 X:152109557-152109579 CCTCTACCCTAGACAGTGTATGG No data
1199893293_1199893299 1 Left 1199893293 X:152109533-152109555 CCCATGTCCAGACATTGGACCAG No data
Right 1199893299 X:152109557-152109579 CCTCTACCCTAGACAGTGTATGG No data
1199893289_1199893299 24 Left 1199893289 X:152109510-152109532 CCACGGGGGTTCCATCTAACCTT No data
Right 1199893299 X:152109557-152109579 CCTCTACCCTAGACAGTGTATGG No data
1199893295_1199893299 -6 Left 1199893295 X:152109540-152109562 CCAGACATTGGACCAGCCCTCTA No data
Right 1199893299 X:152109557-152109579 CCTCTACCCTAGACAGTGTATGG No data
1199893294_1199893299 0 Left 1199893294 X:152109534-152109556 CCATGTCCAGACATTGGACCAGC No data
Right 1199893299 X:152109557-152109579 CCTCTACCCTAGACAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199893299 Original CRISPR CCTCTACCCTAGACAGTGTA TGG Intergenic
No off target data available for this crispr