ID: 1199894440

View in Genome Browser
Species Human (GRCh38)
Location X:152117440-152117462
Sequence TATCATGAGCAGGGCCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199894440_1199894454 23 Left 1199894440 X:152117440-152117462 CCCCTGAGGCCCTGCTCATGATA No data
Right 1199894454 X:152117486-152117508 CCTGGATGTGGACGTCAGAATGG No data
1199894440_1199894446 5 Left 1199894440 X:152117440-152117462 CCCCTGAGGCCCTGCTCATGATA No data
Right 1199894446 X:152117468-152117490 CCCTTTCCCTCCTTCAGCCCTGG No data
1199894440_1199894455 24 Left 1199894440 X:152117440-152117462 CCCCTGAGGCCCTGCTCATGATA No data
Right 1199894455 X:152117487-152117509 CTGGATGTGGACGTCAGAATGGG No data
1199894440_1199894449 11 Left 1199894440 X:152117440-152117462 CCCCTGAGGCCCTGCTCATGATA No data
Right 1199894449 X:152117474-152117496 CCCTCCTTCAGCCCTGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199894440 Original CRISPR TATCATGAGCAGGGCCTCAG GGG (reversed) Intergenic
No off target data available for this crispr