ID: 1199896289

View in Genome Browser
Species Human (GRCh38)
Location X:152130687-152130709
Sequence CCTCTACCCCAGACAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199896284_1199896289 -6 Left 1199896284 X:152130670-152130692 CCACACCTTTGGCCAGCCCTCTA No data
Right 1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG No data
1199896279_1199896289 13 Left 1199896279 X:152130651-152130673 CCATCCAACTTGCCCATGTCCAC No data
Right 1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG No data
1199896280_1199896289 9 Left 1199896280 X:152130655-152130677 CCAACTTGCCCATGTCCACACCT No data
Right 1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG No data
1199896283_1199896289 0 Left 1199896283 X:152130664-152130686 CCATGTCCACACCTTTGGCCAGC No data
Right 1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG No data
1199896278_1199896289 30 Left 1199896278 X:152130634-152130656 CCATCTTCACAGGGTTTCCATCC No data
Right 1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG No data
1199896282_1199896289 1 Left 1199896282 X:152130663-152130685 CCCATGTCCACACCTTTGGCCAG No data
Right 1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199896289 Original CRISPR CCTCTACCCCAGACAGTGTC TGG Intergenic
No off target data available for this crispr