ID: 1199900309

View in Genome Browser
Species Human (GRCh38)
Location X:152166375-152166397
Sequence TTGTGGATATGTGGGGATAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199900309_1199900315 24 Left 1199900309 X:152166375-152166397 CCCATATCCCCACATATCCACAA 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1199900315 X:152166422-152166444 TTACCTACAGACACAGTCTTAGG 0: 1
1: 0
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199900309 Original CRISPR TTGTGGATATGTGGGGATAT GGG (reversed) Exonic
900818948 1:4871529-4871551 GTGTGGGTATGTGTGTATATGGG - Intergenic
903565927 1:24265963-24265985 TTGTAGATATTTGGGGCTATGGG - Intergenic
904394121 1:30206578-30206600 TTGAGGATAGGAGGGTATATGGG - Intergenic
904453281 1:30630603-30630625 TTGTGGCTCTGTGGGGATAAGGG - Intergenic
904585179 1:31576220-31576242 TGGTGGAGAAGGGGGGATATGGG - Intergenic
906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG + Intronic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
908440040 1:64144076-64144098 TTCTGGATATGTGTTGAAATTGG + Intronic
910615138 1:89189247-89189269 GTTTGGATATGTGAGGATACAGG + Intronic
912126971 1:106551252-106551274 TGGTGTATATGTGGGAATTTGGG + Intergenic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912591003 1:110820174-110820196 TTGAGGATATTTGAGGATATTGG + Intergenic
912859908 1:113204665-113204687 TTGTGGATATGGTGAGAGATAGG + Intergenic
912946075 1:114085761-114085783 TGGTGAAGATGTGGAGATATTGG + Intergenic
913929777 1:124941583-124941605 TTGTGGATATTTGGGGATCTAGG - Intergenic
913929937 1:124944654-124944676 TTGTGGATATTTGGAGCTGTTGG - Intergenic
913930267 1:124951632-124951654 TTGTGGATATTTGGAGCTGTTGG - Intergenic
913936323 1:125054099-125054121 TGGTGGATATTTGGGTATTTTGG + Intergenic
915934065 1:160080312-160080334 TGGTGGATGTGTGGGGACAGGGG + Intergenic
916430159 1:164720294-164720316 TTGTGGATATCTGGGGCTCATGG + Intronic
917054569 1:170966185-170966207 TTGTGAAGGTGTGGGGAAATGGG - Intronic
917899898 1:179531608-179531630 TGATTGATATTTGGGGATATTGG + Intronic
918315463 1:183319064-183319086 TAGTGTGTATGTGGGGGTATGGG - Intronic
919195862 1:194285075-194285097 TTGTGGTTATGTGTAGATGTTGG - Intergenic
920606100 1:207388046-207388068 TTTTGTATATGTGGAGAGATAGG - Intergenic
921093006 1:211860670-211860692 TTGTGAATATGTGTGGACAGGGG - Intergenic
923404064 1:233643181-233643203 TCATGCATATGTGGGGTTATAGG + Intronic
924554130 1:245104062-245104084 TGATGGGGATGTGGGGATATAGG + Intronic
1063931280 10:11030686-11030708 TTCTGGATAGGTGGGCATATTGG + Intronic
1064341036 10:14485512-14485534 CTGTGTATATGTGGGGATGGGGG - Intergenic
1064700570 10:18015952-18015974 TTGTGCATGTGTGGGGACAGGGG - Intronic
1066536095 10:36393871-36393893 TTGTGAAGATGTGGGGAAATTGG + Intergenic
1066643821 10:37584686-37584708 ATGTGAAGATGTGGGGAAATTGG + Intergenic
1067420013 10:46137002-46137024 TTGTGATTCTGTGGGAATATGGG + Intergenic
1067426007 10:46212524-46212546 TTGTGATTCTGTGGGAATATGGG - Intergenic
1067505359 10:46843487-46843509 TTGTGATTCTGTGGGAATATGGG + Intergenic
1068065628 10:52127155-52127177 TTGTGTATATTTGGTCATATTGG - Intronic
1068071105 10:52196706-52196728 TTGGGGATTTGTGGGCAGATAGG + Intronic
1068125048 10:52828662-52828684 TTGTGGATGTCTGGGCATTTAGG - Intergenic
1069393436 10:67962128-67962150 CTGTGCATATGTGAGGATAAGGG - Intronic
1070417509 10:76204417-76204439 TAGTGGATATGTGGGTGAATGGG - Intronic
1071007889 10:80903815-80903837 TTTTGGATATGATGAGATATAGG + Intergenic
1071280100 10:84093896-84093918 TTGTAGATGTGTGGGGATAGTGG - Intergenic
1071749366 10:88457299-88457321 TTGGGGATATGTGTGGCTAAAGG + Intronic
1073014182 10:100384947-100384969 TTGAGGATAGGAGGGTATATGGG - Intergenic
1073936492 10:108638919-108638941 TTGTGGTTATGTGATGATAATGG - Intergenic
1074576530 10:114675125-114675147 TTGTGGATACTTGGCGACATAGG - Intronic
1074886150 10:117695341-117695363 TTGGGGATATGAGGTGTTATGGG + Intergenic
1075258607 10:120944608-120944630 GCGTGGATATGTGGGGCTAGTGG - Intergenic
1078134090 11:8637940-8637962 TTGAGGATTTGTGGGGTTCTGGG + Intronic
1080816626 11:35764024-35764046 CTGTGGATATGTGGGAATAGGGG - Intronic
1081053641 11:38379690-38379712 TTGTGTATATGTGGGGATGGGGG + Intergenic
1084693298 11:70739301-70739323 GTGTGGAGATGTGTGGAGATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087071521 11:94086140-94086162 TTGTGGCCATGTGGGGAAACAGG - Exonic
1087344817 11:96958241-96958263 TTGTAGATATGTGATTATATAGG + Intergenic
1087422262 11:97944591-97944613 TTGTGAAGATGTGGAGAAATTGG - Intergenic
1092255571 12:6925250-6925272 TTAGGCATATGTGGGGATAGGGG - Intronic
1094878294 12:34677840-34677862 TAGTGGATATTTGGAGATTTTGG + Intergenic
1095345221 12:41141985-41142007 TGGTGGATTTGGGGGTATATAGG + Intergenic
1095739735 12:45593617-45593639 CTATGGATATGTGGGGACATGGG + Intergenic
1096107039 12:49002362-49002384 TTGTGCATATGAAGGGAGATGGG - Exonic
1096982994 12:55739097-55739119 TTGTATATATGAGGGGTTATTGG - Intergenic
1097663729 12:62457517-62457539 TGGTGGAAATGTGGAGATACAGG + Intergenic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1099493785 12:83319278-83319300 TTGCTGGTATCTGGGGATATGGG - Intergenic
1100526864 12:95427658-95427680 TGGTGGATATGAGGGCCTATGGG - Intergenic
1101444369 12:104727042-104727064 TTGTGGATAAGTGGGTCTCTAGG + Intronic
1103209919 12:119158304-119158326 TTTTGGATATTTTGGGTTATGGG + Exonic
1104766152 12:131331425-131331447 TGGTGGATATGTGGGTGGATGGG - Intergenic
1105774713 13:23646920-23646942 TGGTGGAGATGTGGAGAAATTGG - Intronic
1105778682 13:23687168-23687190 TTGTGTGTATGTGGTGATACTGG + Intergenic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1106885334 13:34178537-34178559 CTGTGGATGTGTTGGGATAGGGG - Intergenic
1106938752 13:34753168-34753190 GTGTAGATATGTGTGTATATGGG + Intergenic
1106940559 13:34774283-34774305 TTGTGAATATGCTGGGAGATGGG - Intergenic
1110684190 13:78352341-78352363 TAGTAGATATTTGGGGACATAGG - Intergenic
1110897908 13:80779351-80779373 TGGTGGACATGTAGGGATATAGG + Intergenic
1111023868 13:82492373-82492395 TTGTGGAGAGGTGTGGATAGAGG + Intergenic
1112268293 13:97946149-97946171 TGGTGGGTATGTGGAGAAATTGG - Intergenic
1112833025 13:103477139-103477161 TTGGGGATGTTTGGGGAAATTGG + Intergenic
1114463444 14:22903167-22903189 TTGTGTGTATGTGGGGGTGTGGG - Intronic
1115003508 14:28451202-28451224 TGGTGGATATGTGGAGAAAAGGG - Intergenic
1115959757 14:38822144-38822166 TTGTGGATGGATGGTGATATTGG - Intergenic
1116128388 14:40819522-40819544 CTATGCATGTGTGGGGATATAGG + Intergenic
1116490416 14:45497905-45497927 TTGAGGATATGAGAGTATATGGG + Intergenic
1117389773 14:55251611-55251633 TTGTGCATATGTGGGAACAGGGG + Intergenic
1118204133 14:63705789-63705811 TGGTGAGTATGTGGGGAAATTGG + Intronic
1119464200 14:74841503-74841525 TTGTGGCCATGTGGGGATATAGG + Intronic
1120161700 14:81152621-81152643 TTGTAGATCTGTGGGAATATGGG + Intergenic
1120784461 14:88519705-88519727 TTGTGGATATAGGGGAAAATGGG - Intronic
1121794981 14:96727340-96727362 ATGTGGGCATGTGGGGATGTGGG + Intergenic
1123079210 14:105683692-105683714 GTGTGGATGTGTGTGGATGTGGG + Intergenic
1124210111 15:27756084-27756106 TTGTGGAGATGTGTGTACATTGG - Intronic
1124468992 15:29966840-29966862 TTGATGGTATGTGGGGGTATGGG - Intronic
1126535800 15:49762569-49762591 TTGTGAATATGTGGACAAATTGG - Intergenic
1129367132 15:75063150-75063172 TTGTAGATGTGTGGGGACAGTGG - Intronic
1130635527 15:85616125-85616147 TTGTGGGGGTGTGGGGATAGGGG - Intronic
1132046766 15:98569992-98570014 TGGTGAAGATGTGGGGAAATTGG + Intergenic
1133542801 16:6772759-6772781 GTGTGCATATGTTGGGATGTGGG + Intronic
1135195805 16:20393602-20393624 ATGAGGAAATTTGGGGATATGGG - Intronic
1137034080 16:35553920-35553942 TTTTAGATACTTGGGGATATTGG + Intergenic
1137397147 16:48124253-48124275 TTGGGAATATGTGGGAATGTGGG - Exonic
1138140428 16:54563693-54563715 ATGTGGACATGTGGGAATTTTGG - Intergenic
1138920387 16:61521462-61521484 TTATGGAGATGTGGAGAAATTGG + Intergenic
1139200863 16:64975542-64975564 TAGTGGATATTTGGGCATCTAGG + Intronic
1139225753 16:65232352-65232374 TTGAGGATAGGAGAGGATATGGG + Intergenic
1143545685 17:7593780-7593802 CTGTGGAAATTTGGGGCTATAGG - Intronic
1143840417 17:9727284-9727306 TTTTAGAAATGTGGAGATATAGG + Intronic
1144713211 17:17416521-17416543 CTGTGGCTCTGTGGGGAGATGGG + Intergenic
1146662320 17:34673090-34673112 TTGTGGATGGCTGGTGATATTGG + Intergenic
1146734148 17:35222946-35222968 TTGGGGAGATGTGGTGATTTTGG - Intergenic
1146734243 17:35223910-35223932 TTGAGGAGATGTGGTGATTTTGG + Intergenic
1147120071 17:38330609-38330631 TTGGGGCTTTGTGGGGATACTGG + Exonic
1147576078 17:41599787-41599809 TTGTGGCCATGTGGGCAGATAGG + Intergenic
1148973347 17:51504396-51504418 TTGTGCATGTGTAGGGATAGAGG - Intergenic
1150333365 17:64312329-64312351 TTGTGGAGATGTTGGCATATGGG - Intergenic
1151282528 17:73087643-73087665 GTGTGGGTATGTGGGACTATAGG + Intronic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1152436140 17:80277619-80277641 GTGTGGATATGTGGATATTTAGG - Intronic
1153376818 18:4390280-4390302 TTGTGAACATGTGGGGACAGGGG - Intronic
1155475139 18:26230114-26230136 TTGTGAACATGTGGGGTTTTAGG + Intronic
1156987067 18:43361150-43361172 TTGTGGTTATGTGGTTATGTGGG + Intergenic
1157405179 18:47416830-47416852 TTGTGGATTTTTTGGGATTTTGG + Intergenic
1158093943 18:53748857-53748879 TTGAGGATATATGGGGAAATAGG + Intergenic
1158289461 18:55923008-55923030 TTGTGGATCTCTATGGATATAGG + Intergenic
1159366402 18:67470939-67470961 GTGTGAATATGTGGGGATGAGGG + Intergenic
1159399151 18:67907558-67907580 ATATGGATATGTGTGAATATGGG + Intergenic
1159623376 18:70665724-70665746 TTGTGAAGATGTGGAGAAATGGG - Intergenic
1161239314 19:3213238-3213260 ATGTGGAAATGTGGGGACAGTGG + Intergenic
1164389784 19:27808009-27808031 TTTTGGATATGGTGGGAGATAGG - Intergenic
1164439852 19:28267034-28267056 TTATGGATATGGGGGAATGTAGG + Intergenic
1166571994 19:43802823-43802845 GTGTGGATGAGTGGGGAGATGGG - Intronic
1168593382 19:57654690-57654712 TGGTGGAGGTGGGGGGATATGGG - Intergenic
925137972 2:1533200-1533222 GGGGGGATATGGGGGGATATGGG - Intronic
928052206 2:28010823-28010845 TTGTGAACCTGTGTGGATATGGG - Intronic
930655304 2:54001914-54001936 TTGTGCATGTGTGGGGACAGGGG - Intronic
931362260 2:61587720-61587742 TTGTGCATGTTTGGGGATAGAGG - Intergenic
932525608 2:72463952-72463974 TTGTGGCCATGTGAGGATACGGG - Intronic
932857919 2:75257181-75257203 TTGTGAAGATGTGGAGAAATTGG - Intergenic
933160241 2:79015711-79015733 TTGTATGTATGTGGGGATTTTGG - Intergenic
933856856 2:86422624-86422646 TTGTGGGTATGTTGAGATACAGG + Intergenic
935489986 2:103707059-103707081 TTGTGAATATATGGGAATATTGG + Intergenic
936534586 2:113302311-113302333 TTGTGAATATGTGTGGGTGTGGG + Intergenic
936953519 2:118001995-118002017 TTGTGGACATCTGGAGAAATAGG + Intronic
937256510 2:120559975-120559997 TTCTGGATCTGTGGTGTTATGGG - Intergenic
939054471 2:137347057-137347079 TGGTGAGGATGTGGGGATATTGG - Intronic
939640457 2:144634536-144634558 TTGTAGATGTGTGGGGATTTTGG + Intergenic
941478838 2:165981258-165981280 TTATGTATATGTGGGAATGTAGG - Intergenic
941584402 2:167339409-167339431 GTGTGGATGTGGGGGGATGTAGG + Intergenic
941933130 2:170962364-170962386 ATGTGGACATGTGGGAATTTGGG + Intronic
941956235 2:171207610-171207632 GTTTGGAGATGGGGGGATATAGG + Intronic
942792268 2:179774228-179774250 TAGGGGATATGTGGGTATAGTGG + Intronic
943875090 2:193057458-193057480 ATGTTGATATTAGGGGATATTGG - Intergenic
944076987 2:195743767-195743789 TTGTGGATATATGTGCTTATTGG + Intronic
944631596 2:201631636-201631658 TTCTGGATTTATGGGGTTATGGG - Intronic
944782014 2:203028894-203028916 TTGTGCATGTGTGGGGACAGGGG - Intronic
945309139 2:208290032-208290054 TTGTGCATGTGTGGGGACAGGGG - Intronic
945798491 2:214394643-214394665 CTGTGCATGTGTGGGGATAGGGG - Intronic
946707932 2:222477287-222477309 GTGTGTATATGTGTGTATATAGG + Intronic
947759636 2:232594429-232594451 ATATAGATATGTGGGTATATGGG + Intergenic
1168952014 20:1808983-1809005 TTGTGGAAGTGTGGAGATATTGG - Intergenic
1170235720 20:14102773-14102795 ATGGGGATATATGGGGATATAGG + Intronic
1170235729 20:14102802-14102824 ATGGGAATATTTGGGGATATAGG + Intronic
1170881964 20:20304737-20304759 GTGTGGAGAAGTGGGGAAATGGG + Intronic
1172237278 20:33386483-33386505 GTGTGTATATGTGTGTATATAGG + Intronic
1172495536 20:35380829-35380851 TTTTGGATTTGGGGGGATTTTGG + Intronic
1174211875 20:48886152-48886174 TTGTGAATATGTAGGGATGGGGG + Intergenic
1175195193 20:57238586-57238608 TGGTGGACATGTGGAGAAATTGG - Intronic
1175509508 20:59514445-59514467 TTGGGGACATGGGGGAATATTGG - Intergenic
1177816051 21:25978211-25978233 TTGTTTATTTGTGGGGGTATAGG - Intronic
1183249467 22:36719708-36719730 TTGTGGATGAGTGGGGTTTTGGG + Intergenic
1184620660 22:45673723-45673745 ATGTGGATATGTTGGAAGATTGG + Intronic
1185243440 22:49759708-49759730 TGGTGGCGATGTGGGGAAATTGG + Intergenic
949136801 3:576985-577007 TTTTAGATATGGGGGGATACAGG - Intergenic
951021357 3:17784222-17784244 TTGGGGATATGGGGAGATGTTGG - Intronic
952471530 3:33658690-33658712 TGGTAGATATGAAGGGATATTGG - Intronic
956510805 3:69991299-69991321 TTGTGTCTATGTGGGGGCATTGG - Intergenic
957014848 3:75051128-75051150 TTGTGCATGTGTGGGGAGAGTGG + Intergenic
957797925 3:85035592-85035614 TTTTGTATATGGGGGGAGATAGG + Intronic
959014281 3:101115072-101115094 TTGTGAAAATGTGGAGAAATTGG + Intergenic
959058862 3:101597396-101597418 ATGTGCATGTGTGGGGATAAAGG + Intergenic
959647312 3:108717825-108717847 TTGTGGATGTGTAAGGAAATGGG - Intergenic
959922667 3:111885488-111885510 TCCAGGATATGTGGGAATATAGG + Intronic
960387190 3:117034603-117034625 TTGTGTATGTGTGTGCATATGGG + Intronic
960425949 3:117508208-117508230 TTGGGGAAATGTGGGGGTTTGGG - Intergenic
960777190 3:121270081-121270103 CTTTGGATATGTTGTGATATTGG + Intronic
960959432 3:123059078-123059100 GTGTGTGTATGTTGGGATATGGG + Intergenic
962388134 3:134949405-134949427 GTGTGGAGAGGTGGGGAAATGGG - Intronic
962601453 3:136994147-136994169 TTGGGGAGAAGTGAGGATATGGG + Intronic
963663508 3:148154840-148154862 TTGAGGATAGGAGAGGATATGGG - Intergenic
964128630 3:153263387-153263409 CTTTGGATATGAGGGCATATGGG + Intergenic
964361941 3:155907831-155907853 TTTTGGATATTTGGGGAAAGAGG + Intronic
964433134 3:156625539-156625561 TTATGGATCTGTGGGGACACAGG + Intergenic
964579397 3:158215490-158215512 TTATGGATATGTTTGGATTTAGG + Intronic
966443061 3:179968055-179968077 TTGTGGATTTATTGGGTTATAGG - Intronic
966658911 3:182392179-182392201 TTTTCCATATGTTGGGATATAGG + Intergenic
967196252 3:187028645-187028667 TTGGGGACAAATGGGGATATTGG - Intronic
967363621 3:188660736-188660758 TTGTGGGGATGGGGGTATATGGG - Intronic
970445167 4:16117300-16117322 TTGTGGATATTTGTGGAAAGAGG + Intergenic
971590157 4:28457150-28457172 TTTTGGATTTGTGGGCATATAGG - Intergenic
971995725 4:33961968-33961990 TTTTGTATATCTGGGGATCTGGG - Intergenic
972516268 4:39813267-39813289 TTGTGATTGTGTGTGGATATGGG + Intergenic
974477451 4:62402039-62402061 TTGTGGATATTTGCTGATAATGG + Intergenic
975244223 4:72099897-72099919 TTATGTATATGTGTGGAAATGGG - Intronic
975529501 4:75386048-75386070 TTCTGGCTATGGGGGGATGTGGG - Intergenic
976621127 4:87128465-87128487 TTTTGCATTTGTGGGGATTTAGG - Intronic
977717701 4:100200896-100200918 TTGTTGTTATGCGGGGACATTGG + Intergenic
978129560 4:105178652-105178674 TTGTGGGTCTGTGGGGACAGGGG + Intronic
980451986 4:132985671-132985693 TAGTGGATGTGTGGGTATGTGGG - Intergenic
981441713 4:144791181-144791203 TTGTTGATATATAGGAATATTGG + Intergenic
982807302 4:159782421-159782443 CTGTGCATGTGTGGGGATAGAGG - Intergenic
985315736 4:188657261-188657283 CTGTGTATATGTGGTGAAATGGG - Intergenic
986452764 5:7882476-7882498 CTGTGGATAAGTGGCTATATGGG - Intronic
986867895 5:12011276-12011298 TTGTGAATATGTGAGGATGAGGG - Intergenic
986995840 5:13606228-13606250 TTGTAGATATTTCAGGATATAGG - Intergenic
987273209 5:16335006-16335028 TTGTACATGTGTGGGGGTATGGG + Intergenic
989897429 5:47109992-47110014 TTGTGGATATTTGGAGCTGTTGG + Intergenic
989898173 5:47123794-47123816 TTGTGGATATTTGGAGCTGTTGG + Intergenic
989899268 5:47144068-47144090 TTGTGGATATTTGGAGCTGTTGG + Intergenic
989899491 5:47148157-47148179 TTGTGGATATTTGGAGCTGTTGG + Intergenic
989899715 5:47152248-47152270 TTGTGGATATTTGGAGCTGTTGG + Intergenic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
992946246 5:81813579-81813601 TTGTGCATATGTTGGAATAAGGG + Intergenic
993941337 5:94062758-94062780 ATGTGGAGATGTGGGGCTGTTGG - Intronic
994305899 5:98203835-98203857 TTGTGGATTTATGGGAATGTGGG + Intergenic
994490868 5:100441691-100441713 GTGTGTATATGTGTGTATATAGG + Intergenic
994883916 5:105533239-105533261 TTGTCTATATGTGTGGATGTAGG + Intergenic
995116672 5:108488464-108488486 GGGTGGATATGGGGGGATCTTGG - Intergenic
995542216 5:113196434-113196456 TTGTTGCTAGGTGGGAATATGGG + Intronic
996028432 5:118678061-118678083 GTGTGGATATGTGTGTTTATAGG + Intergenic
997321171 5:132979913-132979935 TTGTGAAGATGTGGAGAAATTGG + Intergenic
998844184 5:146290248-146290270 TTATCAACATGTGGGGATATTGG + Intronic
999212108 5:149898760-149898782 TTTTGCCTATGTGGGGATAGGGG + Intronic
1000949181 5:167459648-167459670 TGGTGTGTATGTGGAGATATTGG - Intronic
1002643014 5:180639529-180639551 TGGTGGAAAGGTGGGCATATGGG + Intronic
1007528288 6:42516290-42516312 TTGTTGATAGGTGGGCATTTGGG - Intergenic
1009391435 6:63148475-63148497 TTGTGGTTATGTTTGGATACAGG - Intergenic
1009481116 6:64159076-64159098 TTGGGGATTTGTGGGGATTTGGG - Intronic
1012416644 6:99020305-99020327 TTATGGGTCTGTGGGGACATAGG - Intergenic
1014343165 6:120233663-120233685 ATGTGGAGATATGGGGATAGTGG - Intergenic
1015444268 6:133285340-133285362 ATGTGGATATCTGGGGAAAGTGG + Intronic
1015878570 6:137848027-137848049 TTGTGGTTCTCTGGGGCTATAGG - Intergenic
1017389046 6:153918461-153918483 TTATGGATATTTGTGGATACTGG - Intergenic
1018472759 6:164111370-164111392 TTGAGGATAGGTGGGGACAAGGG - Intergenic
1021643678 7:22766084-22766106 TTGTGCATATGTGGGGCCAGAGG - Intergenic
1021743642 7:23715112-23715134 TTGGGGTTATGGTGGGATATAGG + Intronic
1021747228 7:23754462-23754484 TTGTGAATATGTGGTGAGTTGGG + Exonic
1023892022 7:44399654-44399676 TGGTGGGGATGTGGGGATATAGG + Intronic
1025315714 7:58024883-58024905 TGGTGGATATTTGGAGATTTTGG + Intergenic
1025568885 7:62529995-62530017 TAGTGGATATTTGGAGATTTTGG + Intergenic
1025568943 7:62531187-62531209 TAGTGGATATTTGGAGATTTTGG + Intergenic
1025872261 7:65446186-65446208 CAGTAGATATGTGGGGAAATGGG - Intergenic
1027630775 7:80602577-80602599 TTGTGGATATGTGAGGTTTAAGG - Intronic
1029410798 7:100409121-100409143 TGGTGGATAGGGAGGGATATAGG - Intronic
1030441530 7:109594552-109594574 TTGAGGATATGAGAGTATATGGG + Intergenic
1030723445 7:112897545-112897567 TTGAGGGTATATGGGGATATTGG - Intronic
1031249283 7:119358626-119358648 TTGTGGAGGTGTGGGAATAGTGG + Intergenic
1033112979 7:138599280-138599302 TTCTGAAAATGTGGGGGTATAGG + Intronic
1033431769 7:141295838-141295860 TTCTGGAAATGTGGGGACAAAGG - Intronic
1035519901 8:267099-267121 GTGTGGGGATGTGGGGAGATGGG + Intergenic
1035823935 8:2624263-2624285 TTGTGGAGATGTGGAGAAAAGGG + Intergenic
1037725920 8:21482605-21482627 TTGTGGATGTGTTGAGATTTAGG - Intergenic
1039017210 8:33164183-33164205 TTTTGAATCTGTGGGGTTATGGG - Intergenic
1040406154 8:47105043-47105065 TTGTGGATATAAGGGGATTTGGG - Intergenic
1040618667 8:49064802-49064824 ATGGGGATTTGTGGGGAAATGGG + Intronic
1040833150 8:51700575-51700597 GTGTGTATATGTGTGTATATGGG - Intronic
1041117760 8:54556623-54556645 TGGTGGAGATGTGGGGAAACTGG + Intergenic
1041797035 8:61756219-61756241 TAGTGGATATGTGGGAAAATTGG + Intergenic
1041979065 8:63834495-63834517 TCATGGATATGTGGTGATATAGG + Intergenic
1043035517 8:75192814-75192836 TTGTGCATATGTGGGGTCAGGGG + Intergenic
1043195760 8:77289465-77289487 CTTTGGACATGTTGGGATATGGG - Intergenic
1043387095 8:79759161-79759183 TAGTGGGAATGTAGGGATATTGG - Intergenic
1043423531 8:80124898-80124920 TTGTGCATATATGGGGACAGGGG - Intronic
1043477442 8:80619153-80619175 TTGTGGTGCTGTGGGGATTTAGG - Intergenic
1045816763 8:106285448-106285470 TTGTGGATATTTTGGAGTATTGG + Intronic
1047749981 8:127873076-127873098 TTGGGGTTAGGTGAGGATATGGG + Intergenic
1048757136 8:137752159-137752181 CCCTTGATATGTGGGGATATGGG + Intergenic
1049393742 8:142386239-142386261 GTGTGGCTATCTGGGGAAATGGG + Intronic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1052137358 9:24929588-24929610 TTGTGTCTATGTAGGCATATGGG + Intergenic
1052332410 9:27283177-27283199 TTCTGGATATGTATGGATATGGG - Intergenic
1053187493 9:36030281-36030303 TTGTGCATATGTGAGGACAGAGG - Intergenic
1055115836 9:72604452-72604474 TTGTAGAAATGTGAAGATATTGG - Intronic
1056406340 9:86279427-86279449 TTCTAGATATGTAGGGAAATAGG + Intronic
1060496393 9:124122323-124122345 ATGTTGATATGTGGGAATTTAGG + Intergenic
1062200344 9:135299585-135299607 TTGAGGAGGGGTGGGGATATAGG - Intergenic
1185978975 X:4755355-4755377 TTGTGCATGTGTGGAGATAGGGG - Intergenic
1187670361 X:21659961-21659983 TGCTGGATTTGTGGGGATTTGGG + Intergenic
1187754695 X:22509747-22509769 TTGTGCTTGTGTGGGGAAATAGG - Intergenic
1188106546 X:26154221-26154243 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106549 X:26154229-26154251 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106552 X:26154237-26154259 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106555 X:26154245-26154267 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188339747 X:28984685-28984707 CTGTTGATGTGTGGGGATAATGG - Intronic
1189120503 X:38389249-38389271 ATGTGGATATGTGGTTATAGTGG - Intronic
1189671857 X:43419427-43419449 TTGTGGGTATGTTGGCAAATGGG - Intergenic
1193022150 X:76802148-76802170 TTATGGGTCTGTGGGGACATAGG + Intergenic
1194518413 X:94888125-94888147 TTGTGGATATTGGGTAATATTGG + Intergenic
1195283744 X:103362286-103362308 ATGTGAATATTTGTGGATATGGG - Intergenic
1196371969 X:114989201-114989223 TTCTGTATATGTTGGGAGATAGG - Intergenic
1198557428 X:137809962-137809984 TTGTAGGTATCTGGGGAAATTGG - Intergenic
1198707668 X:139466508-139466530 ATGTGTATATGTGCTGATATAGG - Intergenic
1199900309 X:152166375-152166397 TTGTGGATATGTGGGGATATGGG - Exonic
1201492697 Y:14559651-14559673 TTCTGGCGATGAGGGGATATGGG - Intronic