ID: 1199900668

View in Genome Browser
Species Human (GRCh38)
Location X:152168965-152168987
Sequence CAGAGCAACCCCTATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199900668 Original CRISPR CAGAGCAACCCCTATGAGGT AGG Intronic
902624316 1:17667753-17667775 CAGAGCTGCCCCTGTGAGCTGGG + Intronic
904073684 1:27823235-27823257 CCCAGCAACCCTTATAAGGTAGG - Exonic
905546957 1:38807618-38807640 CAGAGCAACCCCATCGATGTGGG + Intergenic
905847927 1:41248808-41248830 CACAGCAACCCTTATGGTGTAGG + Intergenic
909000668 1:70213733-70213755 CATAACAACCCCAATGAGGTGGG + Intronic
911237044 1:95422781-95422803 GTGAGCAACCCCTATAAGGTAGG - Intergenic
912587211 1:110778059-110778081 CAGAGCAACTGCTATGAGTAGGG - Intergenic
912713090 1:111963491-111963513 CACAGCAACCCTTATCAAGTAGG - Intronic
913065688 1:115252090-115252112 CAGAGCAGCTCCTAAGAGGAAGG + Intergenic
913701686 1:121380593-121380615 CATAATAACCCCAATGAGGTTGG - Intronic
914042247 1:144061062-144061084 CATAATAACCCCAATGAGGTTGG - Intergenic
914135843 1:144899426-144899448 CATAATAACCCCAATGAGGTTGG + Intronic
915605526 1:156947887-156947909 CAGATCATCCTCTAGGAGGTGGG + Exonic
917669356 1:177257568-177257590 CAGAGCACCCACTCTGAGGCAGG + Intronic
918177802 1:182060721-182060743 CTGAGCAAGTTCTATGAGGTTGG - Intronic
920489110 1:206399313-206399335 CATAATAACCCCAATGAGGTTGG - Intronic
921476928 1:215622303-215622325 CACAGCGACCCTAATGAGGTAGG - Intergenic
922684214 1:227626675-227626697 CAGAGCAAACCATGCGAGGTGGG + Intronic
923921510 1:238569529-238569551 CAGAGCAACTCCTATTTGTTTGG + Intergenic
924421056 1:243910513-243910535 CTGAGCACTCCCCATGAGGTGGG + Intergenic
1065415737 10:25483336-25483358 CAGTGCAAGCGCTTTGAGGTGGG - Intronic
1066616807 10:37303133-37303155 GAGAGCAACCCCTCTCATGTAGG + Intronic
1067142945 10:43671380-43671402 CACAGCAACCCTTCTGAGCTCGG - Intergenic
1073461149 10:103666699-103666721 CAGAACAATTCCCATGAGGTAGG - Intronic
1075121754 10:119669673-119669695 AATAGCAACCTCTATGGGGTGGG + Intronic
1077805210 11:5584048-5584070 CAGAACAACCATTATGATGTCGG - Intronic
1080684923 11:34507331-34507353 CAGAACAACCACTCTGAGATAGG + Intronic
1083259592 11:61515989-61516011 CACAACCTCCCCTATGAGGTAGG + Intronic
1083280879 11:61626763-61626785 CAGAGCAATCTCTTCGAGGTTGG - Intergenic
1084954478 11:72684142-72684164 CAGAGCGACCCACAGGAGGTGGG + Intergenic
1085661949 11:78376401-78376423 CACAACAAGCCCTATGAGATAGG + Intronic
1091128536 11:133123935-133123957 CAGAGCCACCCCCAAGAAGTTGG + Intronic
1091441592 12:515160-515182 CAAAAAAACCCCTTTGAGGTAGG - Intronic
1091813670 12:3420110-3420132 GAGAACATCCCATATGAGGTGGG - Intronic
1095422022 12:42034093-42034115 CACAACACCCCCTCTGAGGTAGG + Intergenic
1097466044 12:59925991-59926013 CACAGCAACCCGGATGAGATTGG + Intergenic
1099263217 12:80410427-80410449 TTGATCATCCCCTATGAGGTAGG - Intronic
1100887799 12:99091793-99091815 CACAATAACTCCTATGAGGTAGG + Intronic
1101262250 12:103045103-103045125 CAGTAACACCCCTATGAGGTAGG - Intergenic
1102080146 12:110091253-110091275 CAGAACAAACCACATGAGGTTGG - Intergenic
1103186460 12:118961950-118961972 CATATCAATCCCTATGAGATAGG + Intergenic
1105475884 13:20727840-20727862 CAAAGCAAGTCTTATGAGGTGGG + Intergenic
1105509696 13:21040837-21040859 AGAAGCAACCCCTATGAGGATGG + Intronic
1113577502 13:111404595-111404617 CTGAGGAACCCCTTTGATGTTGG + Intergenic
1115230976 14:31160143-31160165 CACAACAAAACCTATGAGGTGGG + Intronic
1116446988 14:45021998-45022020 CAGAGCAGGCCATGTGAGGTGGG + Intronic
1122079479 14:99257024-99257046 CACAGCAACCCTAATGAGGTGGG + Intronic
1130905150 15:88234929-88234951 CAGTGCAACGCCTCTCAGGTTGG - Intronic
1132153329 15:99477562-99477584 CACTAGAACCCCTATGAGGTGGG + Intergenic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1135039554 16:19107539-19107561 CAGAACAAGCCCAATGAGGCAGG - Intergenic
1135826313 16:25731643-25731665 CAGAGACACTCTTATGAGGTAGG + Intronic
1137764642 16:50968464-50968486 CTGAACCTCCCCTATGAGGTAGG - Intergenic
1138654004 16:58480061-58480083 CAGACCAACCTGTAGGAGGTGGG + Intronic
1138895213 16:61196438-61196460 CAGAGCAACTCTTAGGAGTTTGG - Intergenic
1140201295 16:72896999-72897021 CAGAGCAGCCCCTCTGAGCCAGG + Intronic
1141657039 16:85421953-85421975 CACAGCACCCCCCTTGAGGTAGG + Intergenic
1143530790 17:7502176-7502198 CTGAGAAACCCCTAACAGGTGGG + Intronic
1147476853 17:40720167-40720189 CAGAACAACCCCAAGGAGATAGG - Intergenic
1148233099 17:45949435-45949457 CAGAGCAACCCCTTTGGGAAAGG - Intronic
1150105934 17:62462521-62462543 CAAAGCAACCCCTAAGAGCAGGG + Intronic
1150322962 17:64231832-64231854 CCCAGCAGCCCCTATGAGATAGG - Intronic
1153035456 18:757919-757941 CATAGTAAACCTTATGAGGTAGG - Intronic
1157328686 18:46687565-46687587 CTGAGCCACCTTTATGAGGTGGG - Intronic
1158287637 18:55902250-55902272 CAAAGCAACCCTTGTAAGGTAGG + Intergenic
1159879304 18:73843624-73843646 CAGAGCATCCCAGATGAGATGGG + Intergenic
1160688169 19:446952-446974 CATGGCAAAGCCTATGAGGTGGG - Intronic
1165619175 19:37230120-37230142 CAGAGCAACATCACTGAGGTGGG + Intronic
1165701393 19:37941151-37941173 CACAGCAACACCTAGGAGGACGG - Intronic
1168108812 19:54180710-54180732 CAGAGCCAGCCCTTGGAGGTGGG + Intronic
926937872 2:18104222-18104244 CAGAGCAACCCTTAGGAGAGAGG - Intronic
929001066 2:37347282-37347304 CACAGCAAGCCCCATGAGGAAGG + Intronic
934105022 2:88687662-88687684 CAGAGCAAACCATATCAGCTGGG - Intergenic
935224849 2:101044611-101044633 CAGAAGCACCCCTATGAGGATGG + Intronic
935414854 2:102804451-102804473 CACAGCAACCTGGATGAGGTTGG - Intronic
938426004 2:131188228-131188250 CAGGGAAACCCCTATGAAATGGG + Intronic
940961370 2:159790109-159790131 CTGAGCAACTCCTATGTGTTAGG + Intronic
941760569 2:169237985-169238007 GAGAGCTACCCAGATGAGGTAGG + Intronic
942525976 2:176853433-176853455 CAGAGCAAAGCCTATTGGGTAGG + Intergenic
946627689 2:221631906-221631928 CAGTGCCACCCCTATCATGTAGG - Intergenic
948547864 2:238745543-238745565 CAGAGCAGCCCCTGGGAGGGAGG + Intergenic
1169183492 20:3591973-3591995 CAGAGCATGACCTGTGAGGTGGG - Intronic
1170560893 20:17557404-17557426 CAGAGAAGCCCCCTTGAGGTAGG - Intronic
1170763226 20:19270022-19270044 CAGAGCAGCCCCAATGAAATGGG - Intronic
1172563250 20:35907633-35907655 CAGAACAAACCCTCTGAGGTGGG + Intronic
1174198897 20:48793448-48793470 AAGAGAAACACCTATGAGATAGG + Intronic
1178957902 21:37039846-37039868 CAGAGCAAGCCCTGTGAGACAGG - Intergenic
1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG + Intronic
1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG + Intronic
1183142958 22:35961558-35961580 CCCAGGAACCCCTGTGAGGTTGG - Intronic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
950142610 3:10625674-10625696 CAGGGCTACCCCTCTGTGGTGGG + Intronic
950923703 3:16719299-16719321 CACAATAACCTCTATGAGGTTGG - Intergenic
954818575 3:53304407-53304429 CAGAGCAAACATTTTGAGGTTGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
956814469 3:72895216-72895238 CAGAGCAACCCAGATGGGGTAGG + Intronic
958938053 3:100279249-100279271 CATAACAATCCCTATGAGGTAGG - Intronic
961382266 3:126503578-126503600 CAGGGCAGCCCCTATCAGGCCGG + Intronic
967048370 3:185758466-185758488 CAAAGCAAACCCTGTGAGGTAGG - Intronic
968360384 3:198142879-198142901 CAGAGAACCACCAATGAGGTGGG + Intergenic
968375138 4:33923-33945 TAGAGCAGCCCCAATGAGGAAGG - Intergenic
969406161 4:6993609-6993631 CAAAGCAGCCCCTTTGAGGAGGG - Intronic
972744870 4:41923104-41923126 CAGCACAAACCCTATGAGATGGG - Intergenic
982256118 4:153453206-153453228 GAAAGCAAACCCTATGAGTTTGG - Intergenic
984200388 4:176713727-176713749 CACAGGAACATCTATGAGGTGGG + Intronic
984843602 4:184091344-184091366 CAGAGCTGCTCCTATCAGGTCGG - Exonic
985459905 4:190095121-190095143 TAGAGCAGCCCCAATGAGGAAGG + Intergenic
985469058 5:26427-26449 TAGAGCAGCCCCAATGAGGAAGG - Intergenic
986539418 5:8828254-8828276 CAAAACATCCCCTGTGAGGTTGG - Intergenic
990739269 5:58895568-58895590 CAGAACAACCTTTATGAGGTAGG - Intergenic
991064487 5:62411224-62411246 CAGAACAACCCTTATGAGGTAGG - Intronic
993752111 5:91682958-91682980 CAGGTCAAGGCCTATGAGGTTGG + Intergenic
997404780 5:133636606-133636628 CATAGTAACCCCTAAGTGGTAGG - Intergenic
998352093 5:141508523-141508545 CAGGGCACCCCCCACGAGGTGGG + Intronic
1001307880 5:170588948-170588970 CACAGCAACCCTGAAGAGGTAGG - Intronic
1002126549 5:177049777-177049799 CAGAACTACCCCAATGAGGTAGG - Intronic
1003414137 6:5893100-5893122 CACAGTAACCCATATTAGGTAGG + Intergenic
1004549649 6:16634376-16634398 CAGAAACAACCCTATGAGGTAGG - Intronic
1005516884 6:26563604-26563626 CAGAGTAACCCTAATGAGATAGG - Intergenic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1006217820 6:32460207-32460229 AAGAGGAACCCCTAGGTGGTCGG - Intergenic
1007851327 6:44805233-44805255 CAGTGCACCCTCTATGACGTAGG + Intergenic
1007930709 6:45687964-45687986 CAGAGCAGCACCTAGGAAGTAGG + Intergenic
1009530938 6:64814351-64814373 CATAGCACACCATATGAGGTGGG - Intronic
1009710788 6:67316041-67316063 CAAAGCAACACCTATGATGTAGG - Intergenic
1010977899 6:82337267-82337289 CAGAGCAAACCCCATGGTGTTGG + Intergenic
1013291101 6:108719466-108719488 CAGAGGAACCCCTTGGAGTTAGG + Intergenic
1014333719 6:120103592-120103614 CAGAGAATCCACTATGAGATGGG - Intergenic
1019259617 7:73754-73776 CAGAGAACCACCAATGAGGTGGG - Intergenic
1022453165 7:30534525-30534547 CAGAGCAAACCCTAATGGGTAGG + Intronic
1028588095 7:92470879-92470901 CAGAGCAGGCCATGTGAGGTGGG + Exonic
1032035094 7:128515726-128515748 CAAAGCAACCCCTAAGAGCAGGG + Intergenic
1032139550 7:129315041-129315063 CAGAGCACCAACTATGTGGTAGG - Intronic
1038134944 8:24775228-24775250 CAGAGTCATCCCTATGAAGTAGG - Intergenic
1038200700 8:25410185-25410207 CAGAGGAACTCCACTGAGGTAGG + Exonic
1040574616 8:48640442-48640464 TAGAGCAACAAGTATGAGGTGGG - Intergenic
1041663391 8:60420507-60420529 CAGAGCAGGCCATGTGAGGTGGG + Intergenic
1045942251 8:107752851-107752873 CAAAACCAACCCTATGAGGTGGG + Intergenic
1046981934 8:120345584-120345606 CAGAGGAACTCCTCTGAGTTGGG + Intronic
1047855120 8:128901079-128901101 TAGAGCAAACCCTTTGAGGTTGG - Intergenic
1057643690 9:96853446-96853468 CAGAGCAGCCCTTGCGAGGTGGG - Intronic
1060104321 9:120863971-120863993 CTGAGCAAAGGCTATGAGGTAGG + Intronic
1062295752 9:135825601-135825623 CAGAGCAACACCCATGAGACCGG + Intronic
1062656643 9:137607091-137607113 CAGACCAGCCTCTGTGAGGTAGG - Intronic
1062745083 9:138206709-138206731 CAGAGAACCACCAATGAGGTGGG + Intergenic
1203574086 Un_KI270744v1:160227-160249 TAGAGCAGCCCCAATGAGGAAGG + Intergenic
1190107323 X:47569778-47569800 CAGAGCCACCCACACGAGGTGGG - Intronic
1191730361 X:64327874-64327896 CACAGCAACACAGATGAGGTTGG + Intronic
1194405722 X:93493964-93493986 GAGAGGAGCCCCTATGAGGAGGG + Intergenic
1195029155 X:100909574-100909596 CACAACAACCCTTATGAGGTAGG - Intergenic
1196389312 X:115191533-115191555 CAGAGCAACCGCTATGGAGGAGG + Exonic
1196739526 X:119012350-119012372 CCAAGCAAACCCAATGAGGTAGG - Intronic
1197031157 X:121817877-121817899 CAGAGCAACCCTTAAAGGGTTGG - Intergenic
1198503713 X:137280414-137280436 CACAGCAGCACCTATGAGGTAGG - Intergenic
1199470694 X:148192350-148192372 CAGAGCAAGCCCTATCATATAGG - Intergenic
1199900668 X:152168965-152168987 CAGAGCAACCCCTATGAGGTAGG + Intronic
1201397814 Y:13567524-13567546 GGGAGTATCCCCTATGAGGTGGG - Intergenic