ID: 1199905515

View in Genome Browser
Species Human (GRCh38)
Location X:152225315-152225337
Sequence AACATAATTCTGCTGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199905514_1199905515 2 Left 1199905514 X:152225290-152225312 CCTGATCATTAACAGACAGACAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1199905515 X:152225315-152225337 AACATAATTCTGCTGCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 145
1199905513_1199905515 3 Left 1199905513 X:152225289-152225311 CCCTGATCATTAACAGACAGACA 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1199905515 X:152225315-152225337 AACATAATTCTGCTGCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199905515 Original CRISPR AACATAATTCTGCTGCTCAC AGG Intronic
900165215 1:1241774-1241796 ACCATCATGCTGCTGCTCCCTGG - Intergenic
908897970 1:68922754-68922776 ACCATTATTCTGCCTCTCACAGG - Intergenic
910088261 1:83430215-83430237 AACAAATGTCTGCTGCTCAAAGG + Intergenic
911360194 1:96866226-96866248 AACATAATTCAGCTCATAACAGG + Intergenic
912244841 1:107950613-107950635 AACAGCTCTCTGCTGCTCACGGG + Intronic
913244211 1:116857361-116857383 AATATAAATCTGCTCCTAACAGG - Intergenic
913375844 1:118151436-118151458 AAAATTATTCTGCTTCTCAGTGG - Intronic
913393458 1:118340254-118340276 AACAGAACTCTGCTGTTCTCAGG + Intergenic
915776892 1:158500155-158500177 AACATAATTCTAGGGCTCATAGG - Intergenic
918234606 1:182568639-182568661 AACATAATTGGGTTTCTCACAGG + Intergenic
918283239 1:183025261-183025283 ATCATGATTTTGCTGCTCTCCGG + Intronic
918683142 1:187380067-187380089 AACCAAATTCTGTTGCTCAAAGG + Intergenic
918687408 1:187435409-187435431 AAAGTAATTCTGCTGCTGGCTGG - Intergenic
920586421 1:207167405-207167427 CATATAATTCAGCTGCTCAGAGG + Intergenic
921593244 1:217027514-217027536 AACATAATTGTGTTGCTAACTGG - Intronic
1063370534 10:5519106-5519128 AAAATAATTCTGCTGCTCCAAGG - Intergenic
1063869700 10:10404277-10404299 AACAGAACTCTTCTGTTCACTGG + Intergenic
1065184818 10:23161487-23161509 AAAATCCTTCTGCAGCTCACTGG - Intergenic
1065414190 10:25466717-25466739 AACAAAATTCTGTTACTTACTGG - Exonic
1065599023 10:27349786-27349808 AACGTAATGCTGATTCTCACTGG + Intergenic
1067948131 10:50704091-50704113 AAAATAATTCAGGTGCTTACAGG + Intergenic
1068539677 10:58277685-58277707 AACGTAATTCTACTGCATACTGG - Intronic
1070883443 10:79869089-79869111 AAAATAATTCAGGTGCTTACAGG + Intergenic
1071186280 10:83049846-83049868 TACATAATTTTGCTGCTGCCAGG + Intergenic
1071650009 10:87385395-87385417 AAAATAATTCAGGTGCTTACAGG + Intergenic
1075208702 10:120470854-120470876 AACACAAATCTGCTACTTACTGG + Intronic
1076286771 10:129307010-129307032 AACATGCTTCAGCTGCTCTCTGG + Intergenic
1076458941 10:130625399-130625421 AAAATATTTCTCCTACTCACAGG + Intergenic
1078015342 11:7608666-7608688 AAAATAACTCTGCTGCTGATTGG + Intronic
1078388382 11:10913154-10913176 ACCAGAATACTCCTGCTCACAGG + Intergenic
1080740519 11:35059769-35059791 TGCATAAATCTGCTGCACACAGG + Intergenic
1080834995 11:35932243-35932265 AACGTTATTCTGCTGCACATGGG + Intergenic
1081903699 11:46652259-46652281 AACAAACTAGTGCTGCTCACAGG + Intronic
1086738616 11:90339324-90339346 AATATAACTCTAATGCTCACAGG - Intergenic
1088612612 11:111592320-111592342 TACATAATTCTGGGGCTCAGAGG - Intergenic
1088929252 11:114333182-114333204 AACCTAGTTTTGCTGCTCAGGGG - Intergenic
1089354400 11:117840424-117840446 AGCATCGTTCTGCTCCTCACTGG + Intronic
1089881739 11:121780640-121780662 ATCCTAATTCTGCTCCTCAGGGG + Intergenic
1092622928 12:10293177-10293199 CACATAATTCGCATGCTCACTGG + Intergenic
1094459683 12:30681760-30681782 AACATGATTTTCCTGGTCACTGG - Exonic
1095472414 12:42551342-42551364 AAAATAACTCTGCTACACACAGG - Intronic
1098868214 12:75786220-75786242 TTCAGAATTCTGCTGCTCACGGG - Intergenic
1103217810 12:119216254-119216276 ATCCTATTTCTGCTGCTGACTGG + Intronic
1104838643 12:131809109-131809131 AACTGGCTTCTGCTGCTCACGGG - Intergenic
1109351435 13:61187588-61187610 AAAAAAAGTCTGCTGCTCAGAGG + Intergenic
1112607207 13:100918570-100918592 AACTCACTTCTGCTGCTGACAGG + Intergenic
1113353292 13:109550863-109550885 AAAATAATTCTGCTGTTGAAAGG - Intergenic
1115414414 14:33114367-33114389 AACATTATTCTGCTGCTTCCTGG + Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1115812370 14:37123902-37123924 AACATAATTGTGATTATCACTGG + Intronic
1117536234 14:56705654-56705676 ACCATTATTCTGAAGCTCACTGG - Intronic
1124137610 15:27048629-27048651 AACATTAATCAGCTGCCCACGGG + Intronic
1129018526 15:72491374-72491396 TACAAAATTCTGAGGCTCACAGG - Intronic
1130183967 15:81661248-81661270 TCCATCATTCTGTTGCTCACTGG - Intergenic
1131304018 15:91225150-91225172 AACTCAATTCTGCTGCACAATGG - Intronic
1133505378 16:6406924-6406946 AACAAAACTCTGCTGCCCATCGG + Intronic
1137347351 16:47676708-47676730 AACAAAATTAACCTGCTCACAGG + Intronic
1138832077 16:60386611-60386633 AATATGATTCTGCTGCATACTGG - Intergenic
1148679413 17:49465135-49465157 AATATGGTTCTGCTTCTCACTGG + Intronic
1152120725 17:78416752-78416774 AACATATTTCTGCGTTTCACAGG - Intronic
1154473571 18:14728375-14728397 TACAGAATTATGCTGCTGACTGG - Intronic
1157839658 18:50944862-50944884 ATGTTAATTATGCTGCTCACTGG + Intronic
1158046904 18:53167261-53167283 AACATGATTCTGCTTCTTAGTGG - Intronic
1158592801 18:58791700-58791722 AACAGAATTTTGTTTCTCACAGG - Intergenic
1158693497 18:59682543-59682565 ATCATAATTCATCTGTTCACTGG - Intronic
1164963446 19:32457348-32457370 AACATATTTATGTTACTCACGGG - Intronic
1165597807 19:37025475-37025497 AACTTAATTCTGTTGCTACCTGG - Intronic
1165794122 19:38508858-38508880 TCCATAATTCTGGTGTTCACAGG + Intronic
1167109969 19:47454442-47454464 AACAAAATGCAGCTGTTCACAGG - Intronic
1167252030 19:48404442-48404464 AAGATCATGCCGCTGCTCACCGG + Intronic
925306619 2:2851370-2851392 AAAATAATTCTGCTGACCCCCGG - Intergenic
926802276 2:16669040-16669062 ATCCTAATTCTGCCACTCACTGG + Intergenic
927943340 2:27119342-27119364 AACATACTTCTGATGCACACTGG - Intergenic
927998906 2:27506360-27506382 AACTAAATTCTGCTGGTCCCTGG - Intronic
930337322 2:50065650-50065672 AACAAAATACTGCTTCTCACTGG - Intronic
930376169 2:50569712-50569734 ATACTAATTCTGCAGCTCACAGG + Intronic
930683658 2:54284989-54285011 AACATAAATTTACTGCTCACAGG + Intronic
931633835 2:64324513-64324535 AATATAAATGTGCTGATCACAGG - Intergenic
932124780 2:69133902-69133924 ATCATGGTTCTGCTGCTTACAGG + Intronic
938591685 2:132743937-132743959 AACATATTTCTTCTGATCCCTGG - Intronic
942460508 2:176165042-176165064 TATATAATCCTGCTGCTCGCAGG + Intronic
1174740643 20:53010447-53010469 AACATGACTCTGCTGTTCAGTGG + Intronic
1178619311 21:34159947-34159969 AATGTAATTCTGTTGGTCACAGG - Intergenic
1181882038 22:25988883-25988905 ATCCCAACTCTGCTGCTCACTGG - Intronic
1182941759 22:34283618-34283640 AGCTTAATTCTGCTGCTAACTGG - Intergenic
1184358901 22:44001891-44001913 AGAACACTTCTGCTGCTCACAGG - Intronic
1185270139 22:49926007-49926029 AACAGAAATGTGCCGCTCACAGG + Intronic
950160939 3:10760753-10760775 AACATAGTTCTGCCACTCGCTGG + Intergenic
951061944 3:18219228-18219250 AATAAAATTCTGCTTCTTACAGG + Intronic
955760357 3:62273603-62273625 AGTTTAATTCTGCTGCTAACAGG - Intronic
957744081 3:84316147-84316169 AACATAAATCTTCTGCCCTCAGG - Intergenic
959020603 3:101184033-101184055 AACATGATTTTGCTGTTCACTGG + Intergenic
964820388 3:160762462-160762484 AACATAACACTGCTTTTCACAGG - Intronic
966418386 3:179713718-179713740 AATATAATTCAGCTTCCCACAGG - Intronic
966454181 3:180095822-180095844 AAAATAATTCTATAGCTCACAGG - Intergenic
967509573 3:190293506-190293528 AAGATAATCATGCTGCTCTCTGG + Intergenic
970775548 4:19669752-19669774 AACATCCTTCTGCAGCTCAGAGG - Intergenic
977955160 4:103018404-103018426 AAAAAAATTCTGGTACTCACAGG + Intronic
978352743 4:107837490-107837512 TGCCTACTTCTGCTGCTCACAGG - Intronic
980324983 4:131332052-131332074 AAAATCATACTGATGCTCACAGG - Intergenic
980379075 4:131987068-131987090 AAGATAATTTTGCTAATCACTGG - Intergenic
982775795 4:159440021-159440043 AACATTATTCTGCTTAACACAGG + Intergenic
984339936 4:178444131-178444153 AACAAAAATCTACTGGTCACAGG - Intergenic
984891537 4:184498571-184498593 AGCAGAATCCTGCTCCTCACAGG + Intergenic
986632918 5:9791900-9791922 AAGAAGATTCGGCTGCTCACAGG - Intergenic
987181836 5:15375811-15375833 TTCAGAATTCTGTTGCTCACAGG - Intergenic
991900180 5:71452742-71452764 AAAACAACTCTGCTACTCACCGG - Intergenic
992971578 5:82065153-82065175 AACATACTTCTGTTGGTCACTGG - Intronic
993442104 5:87969927-87969949 AACCGAATTCTGCTGGGCACTGG - Intergenic
993956816 5:94244261-94244283 AACATAATTCTGCTTCAATCAGG - Intronic
999817838 5:155195578-155195600 ACCAAAGTTCTGCTCCTCACAGG + Intergenic
1006347198 6:33492265-33492287 AACCTACTTCTGCTGGTCAGGGG - Intergenic
1008132896 6:47738739-47738761 ATCATAATTCTGCTACCAACTGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1008594312 6:53026009-53026031 ATCATAATTCTGTTACTCACTGG + Intronic
1009403076 6:63278744-63278766 AACACACTTCTCCTGCTCAAAGG + Intronic
1010736188 6:79446163-79446185 AACATAATTGTATTGCCCACTGG + Intergenic
1010778539 6:79915858-79915880 AATATATTTCTGCTACTAACAGG + Exonic
1012664234 6:101946720-101946742 AACTCAATTCTACTGCTCAAAGG + Intronic
1014447659 6:121547166-121547188 CACATCATTCTGCTGGTCAGTGG + Intergenic
1014504508 6:122238157-122238179 AACAAAATTTTGCTGCTCAATGG + Intergenic
1015004961 6:128268626-128268648 AAAATAATTTTACTGTTCACTGG - Intronic
1015368839 6:132427661-132427683 CACATCATTCTAATGCTCACAGG - Intergenic
1016350480 6:143161923-143161945 AACATATTGCTGCAGATCACAGG + Intronic
1019305739 7:333478-333500 AACACAAATCTGCTGATCCCGGG - Intergenic
1024608736 7:51045279-51045301 AAGGTAATGCTGCTGCCCACAGG + Intronic
1026415494 7:70175869-70175891 AACATAATTTTTGTGTTCACTGG + Intronic
1027305130 7:76886652-76886674 AACAAATGTCTGCTGCTCAAAGG + Intergenic
1027437304 7:78177653-78177675 TACATAATTCTGCTGTTCCCAGG + Intronic
1027544838 7:79514281-79514303 AAAATAATTATGCTGATTACAGG + Intergenic
1028947239 7:96594182-96594204 TGCATAAATCTGCTTCTCACAGG - Intronic
1031361491 7:120854060-120854082 AAAATGATGCTCCTGCTCACTGG + Intronic
1033794433 7:144831078-144831100 TACATAATTCAGCATCTCACTGG + Intronic
1036915821 8:12802900-12802922 AACAGAATTTTACTGCTCATGGG + Intergenic
1039228640 8:35418955-35418977 CACTCAATTCTGCTGCTCACTGG + Intronic
1042393079 8:68258167-68258189 TACATAATTCTGTTTCTCAATGG + Intergenic
1046338855 8:112825939-112825961 AAACTAATTCTGCTGGTCCCTGG + Intronic
1046612232 8:116438682-116438704 AAAATAATTCTGGTGATCAGTGG - Intergenic
1046909280 8:119608303-119608325 AGCATAATTCTGCTCATCAAAGG + Intronic
1047119925 8:121890937-121890959 ATCATAGATCTGATGCTCACAGG - Intergenic
1047558659 8:125962759-125962781 ACCAAAGCTCTGCTGCTCACTGG - Intergenic
1048264258 8:132971588-132971610 AACAAAATTCTACTCCTCTCAGG - Intronic
1049604372 8:143522188-143522210 AACGTCATGCTGCTCCTCACAGG + Intronic
1050530067 9:6580921-6580943 AGGATCATTGTGCTGCTCACAGG + Intronic
1052744433 9:32426339-32426361 AACTCAATCCTGCTGCTCAGGGG - Intronic
1052881589 9:33603997-33604019 AACAGGATTCTGCTGCTCATTGG - Intergenic
1053494729 9:38541840-38541862 AACAGGATTCTGCTGCTCGCTGG + Intronic
1055546823 9:77384968-77384990 AATATAATTTTGATGTTCACTGG + Intronic
1056068947 9:82965907-82965929 TACATCAGTCTGCTACTCACAGG + Intergenic
1056259883 9:84837362-84837384 GTCCTAATTCTGCCGCTCACTGG + Intronic
1058944700 9:109845490-109845512 CACACAATTCCTCTGCTCACTGG - Intronic
1060680708 9:125560986-125561008 AGCATAATTCTGAAGCTCGCAGG - Intronic
1186257685 X:7740409-7740431 AACATCATGGTGCCGCTCACAGG + Intergenic
1186787772 X:12969505-12969527 AGCATAATTCTGCTTCACAATGG + Intergenic
1190843556 X:54169433-54169455 AACATAATTCTGCCACTAATGGG - Intronic
1192219428 X:69187235-69187257 AGCACAACTCTGCTGCTCATTGG - Intergenic
1192388374 X:70697327-70697349 GACATTATTCTGCTTGTCACTGG + Intronic
1194647615 X:96477077-96477099 AAGGTACTTCTGCTGCACACTGG - Intergenic
1194752957 X:97704995-97705017 AACATAATTATCCTCCTCAGAGG - Intergenic
1195320387 X:103717048-103717070 AACATAATCCATCTGCTCCCAGG - Intronic
1196010118 X:110877854-110877876 ATCTTGATTCTGCTGCTTACTGG + Intergenic
1199905515 X:152225315-152225337 AACATAATTCTGCTGCTCACAGG + Intronic