ID: 1199911289

View in Genome Browser
Species Human (GRCh38)
Location X:152289710-152289732
Sequence CAGTGAAAGCACCTGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28650
Summary {0: 1, 1: 1, 2: 82, 3: 2225, 4: 26341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199911289_1199911291 9 Left 1199911289 X:152289710-152289732 CCTGTGTCCAGGTGCTTTCACTG 0: 1
1: 1
2: 82
3: 2225
4: 26341
Right 1199911291 X:152289742-152289764 CACCTATGAGTGAGAACATGTGG 0: 8120
1: 14274
2: 8213
3: 6298
4: 4752
1199911289_1199911293 16 Left 1199911289 X:152289710-152289732 CCTGTGTCCAGGTGCTTTCACTG 0: 1
1: 1
2: 82
3: 2225
4: 26341
Right 1199911293 X:152289749-152289771 GAGTGAGAACATGTGGTGTTTGG 0: 4749
1: 11870
2: 17435
3: 10841
4: 8050

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199911289 Original CRISPR CAGTGAAAGCACCTGGACAC AGG (reversed) Intronic
Too many off-targets to display for this crispr