ID: 1199911293

View in Genome Browser
Species Human (GRCh38)
Location X:152289749-152289771
Sequence GAGTGAGAACATGTGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52945
Summary {0: 4749, 1: 11870, 2: 17435, 3: 10841, 4: 8050}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199911289_1199911293 16 Left 1199911289 X:152289710-152289732 CCTGTGTCCAGGTGCTTTCACTG 0: 1
1: 1
2: 82
3: 2225
4: 26341
Right 1199911293 X:152289749-152289771 GAGTGAGAACATGTGGTGTTTGG 0: 4749
1: 11870
2: 17435
3: 10841
4: 8050
1199911287_1199911293 21 Left 1199911287 X:152289705-152289727 CCTGCCCTGTGTCCAGGTGCTTT 0: 1
1: 4
2: 99
3: 1578
4: 9437
Right 1199911293 X:152289749-152289771 GAGTGAGAACATGTGGTGTTTGG 0: 4749
1: 11870
2: 17435
3: 10841
4: 8050
1199911288_1199911293 17 Left 1199911288 X:152289709-152289731 CCCTGTGTCCAGGTGCTTTCACT 0: 1
1: 1
2: 56
3: 1146
4: 9442
Right 1199911293 X:152289749-152289771 GAGTGAGAACATGTGGTGTTTGG 0: 4749
1: 11870
2: 17435
3: 10841
4: 8050
1199911286_1199911293 22 Left 1199911286 X:152289704-152289726 CCCTGCCCTGTGTCCAGGTGCTT 0: 1
1: 3
2: 57
3: 634
4: 2156
Right 1199911293 X:152289749-152289771 GAGTGAGAACATGTGGTGTTTGG 0: 4749
1: 11870
2: 17435
3: 10841
4: 8050
1199911290_1199911293 9 Left 1199911290 X:152289717-152289739 CCAGGTGCTTTCACTGTTAAATA 0: 1
1: 0
2: 1
3: 28
4: 318
Right 1199911293 X:152289749-152289771 GAGTGAGAACATGTGGTGTTTGG 0: 4749
1: 11870
2: 17435
3: 10841
4: 8050

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199911293 Original CRISPR GAGTGAGAACATGTGGTGTT TGG Intronic
Too many off-targets to display for this crispr