ID: 1199916205

View in Genome Browser
Species Human (GRCh38)
Location X:152343596-152343618
Sequence CTGTGTGAATGGAGAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199916205_1199916208 20 Left 1199916205 X:152343596-152343618 CCAAATTCTCTCCATTCACACAG 0: 1
1: 0
2: 0
3: 20
4: 364
Right 1199916208 X:152343639-152343661 AATTGCAATTAATTTGTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199916205 Original CRISPR CTGTGTGAATGGAGAGAATT TGG (reversed) Intronic
901905579 1:12406693-12406715 TTGAGAGAATGGAGAGAATGGGG - Intronic
903472128 1:23594642-23594664 CTGGGTGAATGGAAAGATCTTGG + Intronic
904307599 1:29600144-29600166 CTGTGGGAAAGGAGAAAATGGGG + Intergenic
905679940 1:39862936-39862958 CTGTGTGCATGGAAATGATTTGG + Intronic
905971965 1:42148674-42148696 CTATGAGAAAGAAGAGAATTAGG + Intergenic
906905433 1:49885535-49885557 CTATGTGACTAGGGAGAATTAGG - Intronic
907096578 1:51786900-51786922 TAGTATGAATGGAGAGAATAAGG - Intronic
907174081 1:52501467-52501489 TGGTGTGAATGTGGAGAATTTGG + Intronic
908375659 1:63537162-63537184 CTAAGTAAATGGATAGAATTCGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909607358 1:77520574-77520596 CTGTATGAAGGGAGAGCATCAGG - Intronic
911567606 1:99482118-99482140 ATGTGTGAAGGAAGAGAATATGG + Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912889906 1:113519063-113519085 CTGTTTTCATAGAGAGAATTAGG - Intronic
915433211 1:155882980-155883002 CTGAGTGAATGAAGATAAGTTGG + Exonic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915951514 1:160192635-160192657 CTGTGTGGCTGTAGGGAATTTGG + Intronic
916340072 1:163723679-163723701 CTGTGTGAATTGAATGAATGTGG - Intergenic
917079193 1:171238508-171238530 CTGAATGAATTGACAGAATTAGG + Intergenic
917222113 1:172743059-172743081 CTGTCTGAAGGCTGAGAATTAGG + Intergenic
917679865 1:177354850-177354872 GTCTGAGAATGGAGAAAATTGGG + Intergenic
917955734 1:180095811-180095833 CTTTGGAAATGGAAAGAATTAGG + Exonic
919040439 1:192380958-192380980 TTTTATGAAAGGAGAGAATTTGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919072247 1:192771116-192771138 CTGTGAAAATGTAGAGAACTGGG + Intergenic
919219733 1:194611747-194611769 GTGGGTGAAAGGAGAGAATGTGG + Intergenic
921613506 1:217239458-217239480 GTGAGAGAATAGAGAGAATTGGG - Intergenic
921712423 1:218386274-218386296 TTGTGTGAATGAAGAGACTGAGG - Intronic
923120970 1:230991041-230991063 CTGAGTGCATGCAGGGAATTTGG + Intronic
923893473 1:238241466-238241488 ATGTGGAAATGGAGAGAATGGGG + Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
924872588 1:248064829-248064851 CTCTGTGAATGGAGATAAAGAGG + Intronic
1062997343 10:1879489-1879511 CTGTTTGAATGAAGAGATTAAGG - Intergenic
1064133570 10:12731253-12731275 CTCTATGAAGGGAGAGAATGTGG + Intronic
1064511636 10:16100388-16100410 CAGTGTGAATGTTGAGAAGTGGG + Intergenic
1065029127 10:21567514-21567536 CTGTGTCAGTGGAGAAAAGTAGG - Intronic
1065387433 10:25147565-25147587 TTGGGTGAATGGGGAGACTTTGG - Intergenic
1065851932 10:29797491-29797513 GTGGTTGAATGGAGAGAATGTGG - Intergenic
1066676834 10:37896900-37896922 CCCTGTGAATGTAAAGAATTTGG + Intergenic
1067471775 10:46543000-46543022 CTGGGTGAATGGAAGGACTTTGG - Intergenic
1067756924 10:49012258-49012280 CTATGTGAATGAAGACAATGGGG + Intergenic
1068249347 10:54416758-54416780 CTGTGAGACTGTAGAGAAATAGG - Intronic
1068559716 10:58500074-58500096 ATGTTGGGATGGAGAGAATTAGG - Intergenic
1070040795 10:72777517-72777539 TTTTGTGAATGGAGAGAGTTAGG - Intronic
1070114793 10:73517826-73517848 CTGTGTGAATAGCTAGAAATGGG - Intronic
1071267924 10:83980806-83980828 GTGTGTGTATGGAGAGAGATGGG - Intergenic
1072097847 10:92199875-92199897 CTGTGTGTTTGGAGAAAAATAGG - Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073808634 10:107127808-107127830 CTGAGAGAATGGAGTGAATGTGG + Intronic
1075298122 10:121296020-121296042 CTTTGTGAATGGATAGAAAATGG + Intergenic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1076946904 10:133657829-133657851 CTGTTTGAATGCAGAGAAAGTGG + Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1078486881 11:11731461-11731483 CCCTGTGATTGGAGACAATTAGG + Intergenic
1081237747 11:40665980-40666002 GTGTGTGAATGTAGAAAGTTTGG + Intronic
1083299125 11:61731107-61731129 CTGGTTGCATGGAGATAATTAGG + Intronic
1083514244 11:63242018-63242040 CTATATGAATGGAGATATTTTGG + Intronic
1084737355 11:71114116-71114138 CTCTGTGAGTTGAGAGCATTAGG - Intronic
1085058373 11:73421843-73421865 CTGTAGGAATTTAGAGAATTTGG + Intronic
1085440849 11:76561154-76561176 TTGTGAGAATGAAGAGAAATAGG - Intergenic
1085851891 11:80130369-80130391 CTGAGTGAGTGCATAGAATTAGG - Intergenic
1087464653 11:98489431-98489453 CTATGTAAATGGAGAGGATGAGG + Intergenic
1087489310 11:98802718-98802740 TTTTGTGTATGGTGAGAATTAGG + Intergenic
1087500673 11:98949345-98949367 ATCTGTGGATTGAGAGAATTAGG - Intergenic
1087877776 11:103378211-103378233 CTGTGTGAAAGGAAGGGATTTGG - Intronic
1088021560 11:105125710-105125732 CTGTGTAAAAGGAGATATTTTGG - Intergenic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088713496 11:112528722-112528744 CTGTGGGAAGTGAGACAATTAGG - Intergenic
1088762240 11:112942915-112942937 CTCCGTGAAATGAGAGAATTGGG + Intergenic
1089385744 11:118066385-118066407 CTGTGTGGATGGAGAGCCTGGGG - Intergenic
1090676496 11:129002685-129002707 CTTACTGAATGGAGAAAATTTGG - Intronic
1091675657 12:2487283-2487305 CAGTGTCGATGGAGAAAATTAGG - Intronic
1092718159 12:11413431-11413453 CTGTGTAACTGGAGAATATTTGG - Intronic
1093201859 12:16197396-16197418 CTATGTGAAGAGACAGAATTGGG + Intronic
1095538564 12:43280914-43280936 CTGTGTGATTGGTGAACATTTGG + Intergenic
1095669889 12:44846602-44846624 TTGTCTGAAAGGGGAGAATTTGG - Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1100154236 12:91778142-91778164 CTTTGTGAATAGGGAGAACTGGG + Intergenic
1100662435 12:96714728-96714750 CAGAGTGAATGGAGATAAATGGG + Intronic
1100863139 12:98828748-98828770 CTGTATGAATGTATAGACTTGGG + Intronic
1101471471 12:105000646-105000668 CAGTGTGGATGGTAAGAATTTGG + Intronic
1101609576 12:106278482-106278504 TTGCATGAGTGGAGAGAATTTGG - Intronic
1103133795 12:118490372-118490394 CTGTTTTTATGGGGAGAATTGGG + Intergenic
1103445707 12:120993969-120993991 CTTTATGAATGGAGAGACTGAGG + Intronic
1104101146 12:125611474-125611496 CTGTCTGAAGGTAGAGCATTAGG + Intronic
1104678867 12:130735028-130735050 ATGAGTGGATGGAGAGAATGTGG - Intergenic
1105760848 13:23512876-23512898 TTGTGTGTTTGGTGAGAATTAGG - Intergenic
1107013792 13:35693404-35693426 CTGAGTAAATGGAGAGACCTGGG + Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110187179 13:72688958-72688980 ATGTGTGAATTGATAGAATAAGG + Intergenic
1111705880 13:91748938-91748960 GTGTGTGAATAGAGAGAAGGGGG + Intronic
1111786921 13:92799745-92799767 GTGTGTGAAGGGAGAGAAAAAGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113449238 13:110394848-110394870 TTGTGGGAGTGGAGAAAATTAGG - Intronic
1113471982 13:110553690-110553712 TTGTGTGACTGGAGACCATTTGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116134398 14:40902052-40902074 CTGCTTGAATGAAGAAAATTTGG + Intergenic
1119099140 14:71863920-71863942 ATTGGTGAATGGAAAGAATTTGG - Intergenic
1119477376 14:74938962-74938984 CTGTGTGAAAGAAGAGAAAAGGG - Intergenic
1119982633 14:79099291-79099313 CTCTGTGCAGTGAGAGAATTAGG - Intronic
1121301690 14:92876937-92876959 CTGTGTGCTAGAAGAGAATTAGG - Intergenic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1122159368 14:99772066-99772088 CTTTGTGAGTGGAGTGATTTCGG + Intronic
1202920978 14_KI270723v1_random:30385-30407 CTGTTTGAATGCAGAGAAAGTGG + Intergenic
1202923939 14_KI270724v1_random:7196-7218 CTGTTTGAATGCAGAGAAAGTGG - Intergenic
1123430753 15:20214030-20214052 CTGTATGTAGGGAGAAAATTGGG - Intergenic
1123953666 15:25311367-25311389 CTGGTTGAAGGGAGAAAATTGGG + Intergenic
1125183064 15:36899166-36899188 CTGTGTGATTTGAAAGAATGTGG - Intronic
1125936251 15:43638861-43638883 CTGGGTGAGGGGAGAAAATTTGG - Intronic
1125949026 15:43735386-43735408 CTGAGTGAGGGGAGAAAATTTGG - Intergenic
1127057866 15:55150918-55150940 GTGTGTGCATGGAGAGCATGAGG - Intergenic
1128993999 15:72283377-72283399 CTGTGTGGAAGGGGAGAAATGGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131038468 15:89241461-89241483 CTGTATGAATGGATAAAATGTGG - Intergenic
1131750452 15:95501494-95501516 CTATGTGATTGTAGAAAATTTGG + Intergenic
1131836050 15:96392286-96392308 CTGTGAGGATGGAGTGAACTTGG + Intergenic
1131961179 15:97791836-97791858 CCGTGAGATTGGTGAGAATTGGG - Intergenic
1133881840 16:9789492-9789514 CTGTCTGAGTTTAGAGAATTTGG + Intronic
1135420230 16:22300919-22300941 CTATGTGAAGGCAGAGATTTTGG - Intronic
1135864241 16:26086122-26086144 ATGAGTGAATTGAGAAAATTCGG - Intronic
1137434628 16:48445440-48445462 CTGTGCAAAGGGAGAGAATGAGG - Intronic
1138311332 16:56026015-56026037 TTGTGTGGATGGAGAGGACTGGG - Intergenic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1141154557 16:81588108-81588130 CTGTGTGGAAGGAGGCAATTAGG + Intronic
1141650947 16:85392880-85392902 CTGGGTGGATGGAGAGACCTCGG - Intergenic
1144370801 17:14589743-14589765 CTGTGTTCAGGGAGAGAAATAGG + Intergenic
1144858156 17:18282256-18282278 CTGTGTTAAGGGTGAGGATTTGG - Intronic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1147149914 17:38508769-38508791 CAGTGTGAATGGAGGCAGTTTGG + Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1149187633 17:54017947-54017969 CTTAGTAAATGGAGAAAATTGGG + Intergenic
1149476231 17:56963344-56963366 CTATGTAAATGGAGAGGATGAGG - Intergenic
1152453152 17:80396469-80396491 CTGTGTGCATGGCTAGACTTGGG - Exonic
1152979765 18:266031-266053 GTGGGAGAATGGATAGAATTTGG - Intronic
1153049642 18:889670-889692 TGGTGGGAATGGAGAGAGTTGGG + Intergenic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156498490 18:37541655-37541677 CTGGGGTAATGGGGAGAATTAGG - Intronic
1156813595 18:41281698-41281720 CTGTGAGACTGGAGCAAATTTGG - Intergenic
1157474333 18:48011765-48011787 CCTGGTGAATGGAGATAATTTGG + Intergenic
1157902485 18:51532957-51532979 CTGTATGAATAGACAGCATTTGG + Intergenic
1158114574 18:53980370-53980392 ATGTGTGAAGTGTGAGAATTGGG - Intergenic
1158222263 18:55161790-55161812 TTGTGTGAACAGAGAGGATTGGG - Intergenic
1158589921 18:58770447-58770469 CTGTCAAAATGGAGAGATTTAGG - Intergenic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1162247365 19:9413027-9413049 CTGTATGAATGTAGAGAATCTGG - Exonic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1163927925 19:20363051-20363073 CTGTGTGAATGGTGAGTGATTGG + Intergenic
1165356198 19:35305652-35305674 CTGTGAGAACTAAGAGAATTAGG + Intronic
1165575984 19:36818560-36818582 CTCTGTGAATGGACAGACTATGG - Exonic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1165968228 19:39602879-39602901 GTGTGTGAATGGAGAGTAAAGGG + Intronic
1167572073 19:50294788-50294810 CTTTTTAAATGGAGAGAATGGGG + Intronic
925602078 2:5618406-5618428 CTGTTAGAATGGATGGAATTTGG - Intergenic
926940587 2:18132040-18132062 AGGTGGGAATGGGGAGAATTTGG + Intronic
927903621 2:26841542-26841564 CTGTGTGATGGGGTAGAATTTGG - Intergenic
927924709 2:27003220-27003242 CTGTGTGCATATAGAGAATCTGG - Intronic
928389914 2:30901352-30901374 TTGAGTGAATGGGGAGAAATGGG - Intergenic
928836114 2:35547308-35547330 CAGTGTGAATGTAGAGATTTTGG + Intergenic
930446449 2:51479614-51479636 CTGGGGGAATAGAGAGGATTGGG + Intergenic
930460918 2:51674125-51674147 CTTTCTGAATGGATAGAAGTAGG + Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
934541960 2:95182985-95183007 TGTTCTGAATGGAGAGAATTTGG - Intronic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
935888523 2:107649786-107649808 CTGGGAGGAGGGAGAGAATTAGG + Intergenic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937556050 2:123157456-123157478 GTGTGTGAATGGAGAATTTTAGG + Intergenic
939072773 2:137563357-137563379 GTGTGAAAATGGAGAGATTTGGG + Intronic
939238691 2:139531379-139531401 CTGTGTGGAAGGAGAGAGATTGG + Intergenic
939262711 2:139830993-139831015 CAGTCTGAATGGACAGAACTGGG + Intergenic
939454325 2:142414653-142414675 GTGGGTGAATGAAGAGTATTGGG + Intergenic
939575813 2:143893369-143893391 CTGTGTCTATGGAGACAAGTCGG - Intergenic
943221095 2:185106905-185106927 CTGTGTCAATTGACAAAATTGGG - Intergenic
945375249 2:209072232-209072254 GTGTTTGAATGGTGAGAATATGG - Intergenic
945583905 2:211632975-211632997 CTGTGGGAATAGGCAGAATTTGG - Intronic
945618334 2:212101935-212101957 CTGTGAGAATGCAGACAAATTGG - Intronic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
945859769 2:215107438-215107460 CTGTTTGAATGAGAAGAATTAGG + Intronic
946143745 2:217713398-217713420 CTGTGTAGATGGGCAGAATTTGG - Intronic
946196689 2:218036332-218036354 CTTTGTGTAAGGAGAGAGTTGGG + Intronic
946673586 2:222132933-222132955 CTCTGTGAATGGAAAGAAAGGGG + Intergenic
948193950 2:236081109-236081131 CTGTCTGGATGGAAAGAAATAGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948363231 2:237437308-237437330 CTGTGAAAATGGAGAGATTGGGG + Intergenic
948932141 2:241138732-241138754 CTGTGTGGATGAAGAGGATGCGG - Exonic
1169418451 20:5438735-5438757 GTGTGGGAAGGGAGAGCATTGGG - Intergenic
1169958041 20:11127774-11127796 TTGTGTCAAAGGAGAGAGTTGGG - Intergenic
1170535210 20:17334442-17334464 CTTTGTGGATGCAGAGAATGCGG - Intronic
1173048123 20:39532246-39532268 ATAAGAGAATGGAGAGAATTTGG - Intergenic
1173707981 20:45127155-45127177 CGGTGAGAATGTGGAGAATTTGG - Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1175308183 20:57992374-57992396 CTTGGTGAAAGGAGAGAATGGGG + Intergenic
1178246710 21:30960190-30960212 CTGTGTGTAAAGTGAGAATTTGG - Intergenic
1178728935 21:35081169-35081191 CTGTGAGAATGGCCAGAGTTAGG + Intronic
1179014382 21:37582860-37582882 CTCTGTAAATGGAGAGAATGGGG - Intergenic
1179188789 21:39106367-39106389 CTGTGTGTGTGGAGAGTGTTTGG - Intergenic
1183272481 22:36870828-36870850 CTGGGTGCCTGGAAAGAATTGGG + Intronic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
951621020 3:24602524-24602546 CTATTTCAATGGAGAGAATGTGG + Intergenic
952664264 3:35885635-35885657 CTCTTTGAAAGGGGAGAATTAGG - Intergenic
953681097 3:45038800-45038822 CTGTCAGGAGGGAGAGAATTAGG - Intergenic
955790374 3:62582903-62582925 CAGAGTGAATGAAGAGAATGTGG + Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
957080555 3:75632587-75632609 CTGTTTGAATGCAGAGAAAGTGG - Intergenic
958550974 3:95611520-95611542 CTGAGTTAAAGGAGAGACTTGGG - Intergenic
959255261 3:104002613-104002635 GTGGGTGAATGGATAGACTTTGG - Intergenic
960064630 3:113357449-113357471 CTGAGTGAAAGCAGAGGATTTGG + Intronic
960447404 3:117764997-117765019 GTGTGGGAAGGGAGAGCATTAGG - Intergenic
961557110 3:127703262-127703284 CTGTGAGAAGGCAGAGAATGTGG - Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
963516132 3:146310860-146310882 TTGTGTAAATGGTGAGAAATAGG + Intergenic
963960156 3:151300730-151300752 CTTTGTGATTGGACAGAATGAGG - Intronic
965108090 3:164384990-164385012 CTATTTGAAGGTAGAGAATTTGG - Intergenic
965430795 3:168585727-168585749 CTGTGTAAATGCAAAGCATTTGG + Intergenic
966578079 3:181525940-181525962 TTGTGTGAATAGACAGAAGTGGG - Intergenic
968579773 4:1384460-1384482 CTGTGTGACTGGTGAGGACTTGG + Intronic
968639020 4:1701073-1701095 CTGTGGTACTGGAGAGAATGAGG - Intronic
971119988 4:23692783-23692805 CTATGTGATTAGAAAGAATTGGG - Intergenic
971135192 4:23860819-23860841 AGTGGTGAATGGAGAGAATTGGG + Intronic
971328738 4:25665089-25665111 CTGTGTGACTTGGGAGAGTTGGG + Intronic
971441190 4:26687952-26687974 TTGTGGGAATGGCAAGAATTTGG + Intronic
971464746 4:26944906-26944928 TTGTGGGAATAGAGAGTATTTGG + Intronic
971924749 4:32993649-32993671 CTGTGTGAAGGGAAATAATTGGG + Intergenic
972267134 4:37472238-37472260 CTCTGAGAATGAAGAGAATGAGG - Intronic
972315604 4:37922895-37922917 CTGTGTGAACGAAGACAATAAGG + Intronic
973261007 4:48163487-48163509 CTGTGTGAATGGAGTTACATAGG - Intronic
973300586 4:48578683-48578705 CTGTGTTAAGGGAAAAAATTGGG - Intronic
974827494 4:67149941-67149963 CTGTGCCAAAGGAGAGAGTTTGG + Intergenic
975170838 4:71230482-71230504 CTGTGTGAAGTGAGAGATTATGG + Intronic
975426126 4:74230250-74230272 GTGTATGAATGGAGTGATTTAGG + Intronic
975452071 4:74540190-74540212 GTGAATGAATGAAGAGAATTAGG - Intergenic
976893076 4:90074556-90074578 CTGAGAGAAGGGAGAGCATTCGG + Intergenic
977726004 4:100297830-100297852 TTTTGGGAGTGGAGAGAATTAGG + Intergenic
979381430 4:120011249-120011271 CTGTGTGTCTGGTGAGAATATGG - Intergenic
979995030 4:127421517-127421539 CTCTATCAATGTAGAGAATTTGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
986170825 5:5313233-5313255 CAGTGTGAAGGCAGAGACTTGGG - Intronic
987355632 5:17061237-17061259 CAGTGTCAGTGGAGAGACTTAGG - Intergenic
988048351 5:25990048-25990070 ATGTGGGAAGGGAGAGCATTAGG - Intergenic
989085693 5:37673749-37673771 ATGGGTGAAGGGAGAGAATCGGG - Intronic
989595958 5:43156374-43156396 CTTTGGGAATAGGGAGAATTTGG + Intronic
989622612 5:43399674-43399696 CTGTGTAATTGTAGATAATTTGG - Intronic
989692928 5:44167003-44167025 CTCTGTGAAGAGAGATAATTTGG + Intergenic
990614939 5:57498247-57498269 ATGGGTGGATGGAGAGAAATAGG - Intergenic
990720610 5:58691531-58691553 CTGTGTGGAAGGAGAAAATGTGG + Intronic
990732976 5:58829692-58829714 TTGTTTGAGTGGAGAGAATTGGG - Intronic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
992230628 5:74659973-74659995 CTGATGGAATGGAGAGGATTAGG + Intronic
992365898 5:76089161-76089183 CTGAGGGAAGGGAGAGCATTAGG - Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992785933 5:80170676-80170698 CTGTGTTTATGGAGAAAACTTGG - Intronic
993693572 5:91033415-91033437 CTCTGTGAATAGTGTGAATTTGG + Intronic
994947672 5:106416738-106416760 CTGTGTGAAAGGAGAAGACTTGG - Intergenic
995023826 5:107396758-107396780 CTGAGAGAATTTAGAGAATTAGG + Intronic
995381239 5:111535961-111535983 CTGTCACAATGGTGAGAATTTGG - Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
996692310 5:126353319-126353341 CTGTTTGATTGGAGAGACTAAGG + Intergenic
996724826 5:126665204-126665226 CTGTGTGAATGAAGACAAAGGGG + Intergenic
997365705 5:133323962-133323984 CTGTGTGAAGGGAGTGCAGTGGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998810286 5:145959524-145959546 CTTTGCAAATGGAGAGAATGAGG - Intronic
998869745 5:146540473-146540495 CTGTGTGTATGCTGAGAATAGGG + Intergenic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
999662965 5:153884694-153884716 CTGTGTGAAAGAAGACAATGTGG - Intergenic
1002439926 5:179258980-179259002 CTGTGTGCAGGGAGAGACTGCGG - Intronic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1002984111 6:2171370-2171392 CTGTGAGAAAGAAGAGAACTAGG - Intronic
1003387859 6:5685508-5685530 CTGTGTGACTGCAGTGAATGAGG + Intronic
1003824513 6:9938312-9938334 CTGCGGGAATGCAGAGAACTGGG - Intronic
1004126834 6:12882246-12882268 CTGCTTGATTGGAGAGAACTTGG + Intronic
1006552274 6:34834420-34834442 CATTGTGAAGGGAGAGAATGGGG + Intronic
1006809280 6:36809672-36809694 ATGTGTTAATTGAGAGGATTTGG - Intronic
1007193238 6:40037827-40037849 CTGTGTGAATGGCATCAATTGGG + Intergenic
1007393401 6:41563331-41563353 TGGAGTGAAAGGAGAGAATTTGG + Intronic
1008171290 6:48210487-48210509 CTATGTAAATGAAGAGAATGAGG - Intergenic
1008496765 6:52141999-52142021 CACTGTTAATGGAAAGAATTAGG - Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1008974855 6:57413191-57413213 CTATGTGAAGGTAGAAAATTTGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009163740 6:60314697-60314719 CTATGTGAAGGTAGAAAATTTGG + Intergenic
1010881861 6:81185825-81185847 CTTGGGAAATGGAGAGAATTTGG + Intergenic
1012372012 6:98518887-98518909 CTGAGTTTATGGAGAGCATTAGG - Intergenic
1012576449 6:100806641-100806663 CTCTGAGAATGGTTAGAATTTGG - Intronic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1014715458 6:124859954-124859976 CAGTATGACTGGAGAGAATGTGG - Intergenic
1015471574 6:133612249-133612271 TTGGGTGAATGGAGATGATTTGG - Intergenic
1016277508 6:142372150-142372172 TTGTGTAAATGGAGAATATTAGG - Intronic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017523359 6:155221482-155221504 CTGTTTCAATGGAGAGAAAAAGG - Intronic
1018053355 6:160030705-160030727 CTGTGAGAACCAAGAGAATTGGG + Intronic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1018887898 6:167956961-167956983 CTAAGTGAAAGGAGAGACTTAGG - Intronic
1019695235 7:2442258-2442280 CTGGGTGAATGGATAAAATGTGG - Intergenic
1022326061 7:29333052-29333074 CTGTGAGAAGGGAGAGAGTGTGG - Intronic
1022457087 7:30566929-30566951 CAGTGTGGATGGGTAGAATTTGG + Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023466264 7:40458524-40458546 TTGTTTAAATGGTGAGAATTTGG + Intronic
1024754685 7:52516024-52516046 CTGTGTGCATGGGAGGAATTTGG - Intergenic
1027589736 7:80102612-80102634 CGGTGAGAATGTAGAGAAATTGG - Intergenic
1027655800 7:80929766-80929788 CTGTGTGACAGGAGTGAAGTGGG - Intergenic
1028971458 7:96863308-96863330 TTGAGTGAATGAAGAGAGTTGGG - Intergenic
1029846592 7:103418257-103418279 CTGTAAGAATGGAAAGACTTTGG - Intronic
1030132986 7:106218911-106218933 CTTTGTGGATGGAGAGGAATGGG + Intergenic
1030278051 7:107741133-107741155 TTATGTGAATGGATAAAATTTGG - Intergenic
1030455453 7:109767118-109767140 ATGGGTGAATGGACAGAAGTAGG + Intergenic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1031767000 7:125792469-125792491 CGGTGAGAATGGAGAAAAATTGG + Intergenic
1032732892 7:134661684-134661706 CTGTGTGAATGGACCGATTAAGG - Exonic
1033023154 7:137747483-137747505 TTGTGTAAATGGAGAGGATGAGG - Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035368937 7:158366521-158366543 CTCTGTGACTGGAGATAATGAGG + Intronic
1035551195 8:527726-527748 GTGTGTGTATGGTGAGAAATAGG - Intronic
1036754441 8:11463253-11463275 CTTTGTGACTGGAGGGACTTAGG + Intronic
1036887281 8:12567677-12567699 CTGTGTTTAAGGTGAGAATTGGG - Intergenic
1036894875 8:12625778-12625800 CTGTGTTTAAGGTGAGAATTGGG - Intergenic
1037377184 8:18243501-18243523 CTGTGTGCATGGAGAACACTTGG - Intergenic
1037580548 8:20243487-20243509 CTGTGAGAAGGGAGACAGTTGGG - Intergenic
1037632531 8:20671342-20671364 CTGTAGGATGGGAGAGAATTGGG + Intergenic
1037935706 8:22913694-22913716 CGGTGTGAATGGTGGGAGTTAGG - Intronic
1039200696 8:35090190-35090212 CTGTGTCAATGAAGAGAAATAGG + Intergenic
1039479081 8:37858462-37858484 ATGTGTGAATAGAGGGTATTAGG - Intergenic
1039857379 8:41427606-41427628 CTGTGTGAAGGGCAAGATTTTGG - Intergenic
1040077491 8:43252321-43252343 CTATGTTCAGGGAGAGAATTGGG + Intergenic
1040392171 8:46959639-46959661 CAGTGTGATTGCAGGGAATTTGG + Intergenic
1040498819 8:47989971-47989993 ATTTGTGATTGGAGAGTATTTGG + Intergenic
1041011860 8:53551469-53551491 CTGTGTGAAGGGACAGGACTGGG + Intergenic
1041195845 8:55400661-55400683 CTGTGGGAATGGAGACCTTTTGG - Intronic
1041278100 8:56184591-56184613 TTGTGTGAATGGATAAAATCAGG + Intronic
1041527594 8:58824448-58824470 CTGAGTGAATGGAGAGAGTGTGG - Intronic
1041679432 8:60573303-60573325 CTGAGTGACTGGAGAAAAATAGG - Intronic
1044406853 8:91837265-91837287 GAGAGTGAATGGAGATAATTTGG + Intergenic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1045619771 8:103962147-103962169 CGATCTGAATGGAAAGAATTTGG - Intronic
1046044296 8:108945967-108945989 ATATGTGCAAGGAGAGAATTAGG - Intergenic
1046665172 8:116994159-116994181 GAATATGAATGGAGAGAATTTGG + Intronic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1046859887 8:119078471-119078493 CTGTTGGAATAGAGAGAATGGGG + Intronic
1047197987 8:122738888-122738910 CTGTCTGAAGGGAGAGAAATTGG - Intergenic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1048123714 8:131609258-131609280 CTGTGTGAAAGAAGAGGCTTGGG + Intergenic
1048167228 8:132073851-132073873 CTGTGTGGATAGGGAGACTTGGG - Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048339302 8:133526382-133526404 CTGGGTGGTTGGAGAGACTTAGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1049178323 8:141207235-141207257 CTGTGTGCATGGAGGAAATCAGG + Intronic
1049460251 8:142723994-142724016 CATTGAGAATGGAGAGATTTAGG - Intergenic
1050418963 9:5442847-5442869 CTGGGGGAATGGGGAGAATGGGG - Intergenic
1050727355 9:8666544-8666566 TTCTGTGAAAGGAGAGTATTTGG - Intronic
1051557560 9:18402078-18402100 CTGGGTGAAGGCAGAGATTTCGG - Intergenic
1051851851 9:21518655-21518677 GTGTGGAAATGTAGAGAATTTGG + Intergenic
1057575770 9:96241148-96241170 CAGTGTGAATGGGAAGAACTCGG + Intronic
1059065105 9:111075484-111075506 GTGTGTGTATGGTGGGAATTAGG - Intergenic
1059442782 9:114319163-114319185 CTGTCTGAATGGGAAGAATGGGG - Intergenic
1060025707 9:120169239-120169261 CTCTGAAAATGGTGAGAATTTGG - Intergenic
1061151729 9:128832510-128832532 GTGTGTGTGTGGAGAGGATTGGG - Intergenic
1186383536 X:9086316-9086338 CTGTGTGATTTCAGGGAATTAGG - Intronic
1187625136 X:21103028-21103050 CTGTGTGTATAGAGAGTATGGGG + Intergenic
1187921841 X:24211079-24211101 TTGTGTGAACTGAGAGAATATGG - Exonic
1188891428 X:35615359-35615381 CTGTTTGAATGTAGGGATTTGGG + Intergenic
1189118827 X:38371628-38371650 CTGTATTAATTGAGTGAATTTGG - Intronic
1192424602 X:71064239-71064261 CTGGTAGAATGGAGAGGATTTGG - Intronic
1193909047 X:87280032-87280054 ATGGGTGAATGGACAGAATTGGG - Intergenic
1195177510 X:102325289-102325311 CGGTGAGAATGCAGAGAAATTGG + Intronic
1195181354 X:102361804-102361826 CGGTGAGAATGCAGAGAAATTGG - Intronic
1196417501 X:115487171-115487193 CTGAGGGAATGGGGAGAATGAGG + Intergenic
1196713978 X:118793605-118793627 CTGTGTGTGAGGAGAGAAATGGG - Exonic
1196982029 X:121225112-121225134 GTGGGTGAAGGGAGAGAATCAGG - Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1200421966 Y:2979696-2979718 TTGTGTGAACTGAGAGAATATGG - Exonic
1201593758 Y:15643664-15643686 TTGTGTGTATGAAGAAAATTTGG + Intergenic
1201938475 Y:19433185-19433207 CAGTGCAAAAGGAGAGAATTAGG + Intergenic