ID: 1199920387

View in Genome Browser
Species Human (GRCh38)
Location X:152396377-152396399
Sequence CACTTTGTTGTGGCATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 1, 2: 10, 3: 65, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199920382_1199920387 28 Left 1199920382 X:152396326-152396348 CCAGAACTGTGAGAAAAACATTT 0: 5
1: 228
2: 1684
3: 4339
4: 7395
Right 1199920387 X:152396377-152396399 CACTTTGTTGTGGCATCCTTGGG 0: 1
1: 1
2: 10
3: 65
4: 451
1199920383_1199920387 -8 Left 1199920383 X:152396362-152396384 CCACCTAGTTTAAAGCACTTTGT 0: 1
1: 0
2: 7
3: 75
4: 673
Right 1199920387 X:152396377-152396399 CACTTTGTTGTGGCATCCTTGGG 0: 1
1: 1
2: 10
3: 65
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199920387 Original CRISPR CACTTTGTTGTGGCATCCTT GGG Intronic
900672253 1:3861980-3862002 CACTTTTTAGTGGATTCCTTAGG - Intronic
902205606 1:14866059-14866081 CACTTTGTTATAGCAGCCCTGGG + Intronic
902673981 1:17995612-17995634 CACTTTGTTATGGCAGCCCCAGG - Intergenic
904730156 1:32584323-32584345 TACTTTGTTATGGCAGCCCTAGG + Intronic
906018280 1:42603204-42603226 CACTTTGTTGCTGCACCCTCTGG + Intronic
908283888 1:62572470-62572492 TACTTTGTTATGGCAGCCTGAGG - Intronic
908314024 1:62915206-62915228 TATTTTGTTGTGGCAGCCCTAGG + Intergenic
908333454 1:63095849-63095871 TACTTTGATATGGCATTCTTGGG + Intergenic
908333540 1:63096620-63096642 GACTTTGTTATGGCAGCCCTAGG + Intergenic
909461270 1:75917199-75917221 CACTTTGTTATGGCAACTCTAGG + Intergenic
909875490 1:80797636-80797658 CACCTTGATGCTGCATCCTTTGG + Intergenic
910126176 1:83844991-83845013 CGCCTTGTTGTTGCATCCTTGGG - Intergenic
912540946 1:110414871-110414893 CAGTTTGTTATGGCAGCCCTAGG + Intergenic
912808720 1:112777166-112777188 TGCTTTGTTATGGCATCCCTAGG - Intergenic
913484177 1:119318577-119318599 CACTTTTCGGTGTCATCCTTGGG + Intergenic
914347965 1:146815936-146815958 TAATTTGTTGTAGCAGCCTTGGG - Intergenic
914453428 1:147813381-147813403 TACTTTTTTGTGGCCTCCTCTGG + Intergenic
916036935 1:160930667-160930689 CAATTTGTTATGGCAACCCTAGG - Intergenic
916671412 1:167024671-167024693 CACGTTGTTGCTGCATCCTTTGG - Intergenic
916723492 1:167502986-167503008 CACTTTGTTAAGGCAGCCCTAGG + Intronic
916861622 1:168812101-168812123 TACTTTGTTGTGGCAGGCCTAGG - Intergenic
916910846 1:169344279-169344301 AACTTTTTTGTGGAATCCTTAGG + Intronic
917188501 1:172388597-172388619 CACTTAGTGTTGGCCTCCTTTGG - Exonic
917354867 1:174116684-174116706 CACTTTGATTTTCCATCCTTTGG + Intergenic
918075855 1:181170968-181170990 CAGTTTGTTATGGCAGCCCTAGG + Intergenic
918508649 1:185285500-185285522 CACTTTTTGGTAGTATCCTTTGG + Intronic
919360295 1:196584241-196584263 CACTGTGTTTTGTCAACCTTTGG - Intronic
919443606 1:197672036-197672058 CAATTTGTTTATGCATCCTTAGG - Exonic
921431690 1:215073300-215073322 CACTTTGTTATAGCAGCCCTAGG + Intronic
921467070 1:215501794-215501816 CACTTTGTTGTGGCAGCCCTAGG - Intergenic
923827851 1:237520195-237520217 GAGTTTTTTGTGGCATCTTTAGG + Intronic
924161515 1:241237845-241237867 TACTGTGTTGTAGAATCCTTTGG + Intronic
1062767844 10:79399-79421 CACTTTGTTACGGCAGCCCTAGG + Intergenic
1063183360 10:3627165-3627187 AACTTTGTCATGGCAGCCTTGGG + Intergenic
1063430471 10:5984160-5984182 TACTTTGTTGCGGCAGGCTTAGG - Intergenic
1063608795 10:7545611-7545633 TACTTTGTTTTGGCAGCCCTGGG + Intergenic
1063653112 10:7960105-7960127 CATTCTGTTTTGGCATCATTGGG + Intronic
1065455883 10:25906250-25906272 CACTTTGTTATGGCAGCCCCCGG + Intergenic
1067460175 10:46452341-46452363 CGCTTTGTTGTGGCAACCCCAGG - Intergenic
1067514115 10:46922026-46922048 CACTTTGTTATGGCAGCCATAGG + Intronic
1067573690 10:47391186-47391208 CAGTTTTTTGTGGAATCTTTAGG + Intergenic
1067627015 10:47932262-47932284 CGCTTTGTTGTGGCAACCCCAGG + Intergenic
1067648138 10:48129806-48129828 CACTTTGTTATGGCAGCCATAGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068067481 10:52149744-52149766 CATTTTGTTATGGCAGCCTCAGG + Intronic
1068156998 10:53212888-53212910 GACTTTGTTGTGGCTACCTGTGG + Intergenic
1071429262 10:85593454-85593476 CACCTTGTTGGGCCATCCGTGGG + Intergenic
1071677508 10:87669016-87669038 CATTTTGTTGTGGCATTCTGGGG + Intronic
1072058096 10:91781025-91781047 CACTTTGTTACAGCAGCCTTGGG - Intergenic
1072135676 10:92543340-92543362 TAATATGTTGAGGCATCCTTGGG - Intronic
1072162368 10:92780560-92780582 TACTTTGTTTTGGTATCTTTGGG - Intergenic
1072603210 10:96952435-96952457 CTTTTTGTTGTGGCATGTTTTGG + Intronic
1072747933 10:97954680-97954702 CACTTTGTTACGGCAGCCCTAGG - Intronic
1072985173 10:100133133-100133155 TACTTTGTTATGGCAGCCCTAGG + Intergenic
1073089561 10:100923172-100923194 CACTTTGTTATGGCAGCCCTAGG - Intronic
1074290163 10:112132368-112132390 TACTTTGTTATGGCAGCCCTAGG - Intergenic
1074723503 10:116284495-116284517 CACTTTGCTATGGCAGCCCTGGG - Intergenic
1075198128 10:120378784-120378806 CACTTTGTTCTGGCAGCCACAGG - Intergenic
1076361969 10:129895894-129895916 GACTTTGTAATGGCATCATTTGG + Intronic
1077590963 11:3490718-3490740 TACTTAGTTGTGGCAGCCCTAGG + Intergenic
1078868697 11:15324053-15324075 TAATTTGTTATGGCATCCCTAGG - Intergenic
1078909973 11:15722017-15722039 CACTTTATTGCCGCATCCTCTGG + Intergenic
1078928447 11:15894815-15894837 CACTCAGTTATGGCATCCCTAGG - Intergenic
1079613153 11:22457884-22457906 CACTTTGTTGCTGCATCTTCTGG + Intergenic
1080512163 11:32985834-32985856 CATTTTGTTATGGCAGCCTGAGG - Intronic
1081069794 11:38596346-38596368 CAGTTTGTTATGGCAACCTTGGG + Intergenic
1081210866 11:40332115-40332137 CACTTTGTTATGGCCGCCCTAGG - Intronic
1082855054 11:57798543-57798565 GAAATTGTGGTGGCATCCTTGGG + Intronic
1083066710 11:59931586-59931608 CACTGTGTTTTGGGATCTTTGGG + Intergenic
1083980371 11:66162689-66162711 TAATTTGTTGTGGCAGCTTTAGG + Intronic
1084246681 11:67862468-67862490 TACTTGGTTGTGGCAGCCCTAGG + Intergenic
1084825998 11:71732023-71732045 TACTTGGTTGTGGCATCCCTAGG - Intergenic
1085443060 11:76580424-76580446 TACTTTGTTATGGCAGCCTCAGG + Intergenic
1086879238 11:92134439-92134461 CAAATTGCTGTGGCATCCATTGG - Intergenic
1088198627 11:107304913-107304935 CATTTTGTTATAGCATCCCTGGG + Intergenic
1088838022 11:113595281-113595303 CACATTGTTATAGCATCCTTAGG - Intergenic
1089022246 11:115228295-115228317 CAATTTGTTATGGCAGCCCTAGG + Intronic
1089161223 11:116439040-116439062 TACTTTGTTATGGCAGTCTTAGG + Intergenic
1090695421 11:129236400-129236422 CACTTTTTTGTGGGATTGTTTGG + Intronic
1090755867 11:129791144-129791166 AACCTTGTTGCTGCATCCTTTGG - Intergenic
1090915190 11:131156821-131156843 CAATTTGTTATGGCAACCCTGGG + Intergenic
1091598921 12:1905455-1905477 CAGTTTTTTGTGGAATCTTTAGG - Intronic
1091724604 12:2837005-2837027 TACTTTGTTATGGCATCCCCAGG + Intronic
1091854965 12:3732022-3732044 CACTTTGTTAAGGCAGCCCTAGG + Intronic
1092958182 12:13569656-13569678 CACTTTGTTATGGCAGCAATAGG + Intronic
1093085961 12:14867243-14867265 CTATTTGTTGTGGCTTCCCTTGG + Intronic
1094833549 12:34311762-34311784 CACTTTGGTGTGCCCTCCCTGGG + Intergenic
1095411116 12:41924354-41924376 GACTTTGTTGTGGCAGCCTTGGG + Intergenic
1095940413 12:47723335-47723357 CACTTTGCTGTGACATTCTGGGG + Intronic
1096893401 12:54794982-54795004 CATTTTGTTGTGGTATCCTGAGG + Intergenic
1097302022 12:58029076-58029098 CATTCTGTTTTGACATCCTTAGG - Intergenic
1097808066 12:63987290-63987312 CACTATGCAGTGGCATCTTTAGG - Intronic
1098146865 12:67506312-67506334 CATTTTGTTGTGGCAGCCCTGGG + Intergenic
1099836933 12:87918761-87918783 TAATTTGTTATGGCAACCTTAGG - Intergenic
1100131528 12:91499747-91499769 CACTTTGTTCCAGCATCCCTGGG + Intergenic
1100337690 12:93647418-93647440 TATTTTGTTGTGGCAGCCTGAGG + Intergenic
1100397600 12:94198564-94198586 TAATTTGTTATGGCAGCCTTGGG - Intronic
1100483963 12:95006939-95006961 CATTTTTTGGTGGAATCCTTAGG + Intergenic
1101558918 12:105837508-105837530 CACTTTGTTATGGCAGATTTTGG - Intergenic
1103300645 12:119924086-119924108 TACTTTGTTATGGCAGCCTTAGG - Intergenic
1104085267 12:125468968-125468990 CAATTTTGTGTGGAATCCTTGGG + Intronic
1104170167 12:126272993-126273015 CACTTTGTTGTAGCAGCCCTAGG + Intergenic
1104262905 12:127201066-127201088 CTCCTTGTTGTGGCATCCTGGGG + Intergenic
1104472071 12:129037206-129037228 CATTTTGTTATGGCAACCCTAGG + Intergenic
1106111110 13:26777690-26777712 CACTGTGATGTGTCATCCCTCGG + Intergenic
1106156168 13:27158714-27158736 CACTTTGTTATGGCAGCCCTAGG + Intronic
1107411542 13:40162790-40162812 CACTTTGTTATGGCAGCCCAAGG + Intergenic
1107991361 13:45821395-45821417 TACTTTGTTGTGGCAGCTCTAGG + Intronic
1108548558 13:51520691-51520713 CAGTTTGTTTTGGCAGCCCTAGG - Intergenic
1109142928 13:58737984-58738006 CACTTTGTTGCAGCAGCCCTAGG + Intergenic
1110140934 13:72128471-72128493 CACTTTCTTCTGGCCTCCATGGG + Intergenic
1110147819 13:72214245-72214267 CAATTTGTTATGGCAGCCCTAGG - Intergenic
1110791838 13:79594138-79594160 TAATTTGTTGTGGCAGCCCTAGG - Intergenic
1111314423 13:86534395-86534417 TCCTTTGTTATGGCAGCCTTAGG + Intergenic
1111559384 13:89925072-89925094 TACTTTGTTATGGCAGCCCTAGG + Intergenic
1111996329 13:95169240-95169262 CACTTTGTTCTGGCAGCCCTAGG + Intronic
1112113314 13:96326661-96326683 CACCTTGTTCTGTAATCCTTTGG + Intronic
1112201850 13:97284093-97284115 TACTTTGTTGTGACAGCCCTAGG - Intronic
1112770849 13:102793155-102793177 CACTTTGTTACGGCAGCCCTAGG + Intronic
1114018098 14:18450520-18450542 CACTGTGTTCTGGAATCCTGAGG + Intergenic
1114232736 14:20798856-20798878 CATTTTGTTATGGCAGCCCTAGG - Intergenic
1117265656 14:54083736-54083758 CACTTTGTTATGGCAGCCACAGG + Intergenic
1118199961 14:63662770-63662792 CACTGTGTTATGGGATCCTTGGG + Intergenic
1118830887 14:69431315-69431337 CACTTTTTTGTAGATTCCTTGGG + Intronic
1119880482 14:78095696-78095718 TAATTTGTTATGGCAGCCTTAGG - Intergenic
1120144253 14:80962289-80962311 TACTTTGTTATGGCAATCTTAGG - Intronic
1120181389 14:81345803-81345825 TACTTTGTTATGGCAGCCTTAGG + Intronic
1120680102 14:87471046-87471068 CACTTTGTTATGGCAGTCCTAGG - Intergenic
1120827584 14:88969613-88969635 TACTTTGTTGTAGCAGCCATAGG + Intergenic
1121240152 14:92423854-92423876 TACTTTGTTATGGCAGCCCTGGG - Intronic
1121731271 14:96188831-96188853 TACTTTGTTGTGGCAGCCGTGGG + Intergenic
1121929851 14:97962660-97962682 TACTTTGTTATAGCAGCCTTAGG - Intronic
1122024200 14:98863240-98863262 GAATTTGTTATGGCAGCCTTAGG + Intergenic
1122528051 14:102403625-102403647 CAATTTTTTGTGGAATCTTTAGG - Intronic
1122638950 14:103145944-103145966 CACTTTGTTGCAGCATTCCTAGG + Intergenic
1123978890 15:25580559-25580581 CTCTCTGTTGTGGCATTCCTCGG - Intergenic
1130066440 15:80608748-80608770 CAATTTGTTGTGGCAGCCTGAGG - Intergenic
1130067977 15:80621009-80621031 CACTTTGTGGTGTCATTCCTTGG + Intergenic
1130073860 15:80671862-80671884 CAATTTGTTATGGCAGCCCTAGG + Intergenic
1130981623 15:88815836-88815858 CACTTTGTTATGGCAGGCCTAGG - Intronic
1132253495 15:100352551-100352573 CCCTTTGTTGTGGGATATTTTGG - Intergenic
1133130395 16:3673048-3673070 CACTCTCTTGTGTCCTCCTTAGG - Intronic
1133356338 16:5139751-5139773 TACTTGGTTGTGGCAGCCTTAGG + Intergenic
1133367946 16:5225906-5225928 CCCTTTGCTGGGGAATCCTTGGG + Intergenic
1133828880 16:9303441-9303463 TACTTTGTTATGGCATCTTCAGG + Intergenic
1133862855 16:9612720-9612742 CAATTTGTTATGGCAGCCCTAGG - Intergenic
1134859616 16:17549614-17549636 CACTTTGTTTTGGCAGCCCTTGG - Intergenic
1135465563 16:22681782-22681804 CACTCTGTTGTGGCCTTCTAAGG + Intergenic
1135898962 16:26438450-26438472 CACTTTGTTATAGCAGCCCTGGG - Intergenic
1138304841 16:55965158-55965180 TGCTTTGTTATGGCAGCCTTAGG - Intergenic
1139312688 16:66040569-66040591 CACTTTCTTGTGCCATGCATGGG - Intergenic
1140141169 16:72259316-72259338 TGCTTTGTTATGGCAGCCTTAGG + Intergenic
1140871954 16:79114687-79114709 CACTTTGTTATGGCAGCCCCAGG + Intronic
1141247914 16:82327756-82327778 CAATTTGTCTTGGCATCCCTTGG - Intergenic
1149211489 17:54307308-54307330 TAATTTGTTATGGCAGCCTTAGG + Intergenic
1149320584 17:55477001-55477023 TACTTTGTTGTGGCAGCCCTAGG - Intergenic
1149540043 17:57461937-57461959 TACTTTGTTATGGCAGCCCTAGG - Intronic
1149614718 17:57988169-57988191 CGCTTTGTTGTCGCCTCCTCCGG - Intronic
1150519697 17:65853073-65853095 TACTTTGTTATGGCAACCCTGGG - Intronic
1150594847 17:66594904-66594926 CAATTTGTTATGGCAGCCCTAGG - Intronic
1150897532 17:69231038-69231060 TACTTTGTTATGGCAGCCCTAGG - Intronic
1151404982 17:73880317-73880339 GAATTTGTTGTGGCAGCCCTAGG - Intergenic
1152323041 17:79619251-79619273 GACTTTGTTGTGGCAGCCCCAGG - Intergenic
1152348452 17:79769293-79769315 AACTTTGTTGTGGCAGCCGGAGG + Intergenic
1152960669 18:78731-78753 CACTTTGTTACGGCAGCCCTAGG + Intergenic
1153982819 18:10326381-10326403 CACATTGTTATGGCAGCCCTAGG - Intergenic
1155267206 18:24105764-24105786 TACTTTGTTATGGCAGCCGTGGG - Intronic
1155271673 18:24147964-24147986 CACTCTGCTGTGTCATTCTTAGG + Intronic
1155503826 18:26513552-26513574 CTCTATGTTGTTGCATCCTCGGG - Intronic
1155548647 18:26941115-26941137 TACTTTGTTTTGGCAGCCCTAGG + Intronic
1155626902 18:27845226-27845248 CAATTTGTTATGGTATCCCTAGG - Intergenic
1155792417 18:29990071-29990093 CAATTTGTTATGGCAGCCCTGGG + Intergenic
1156910536 18:42406762-42406784 CTCTTTGGTCTAGCATCCTTAGG - Intergenic
1157042747 18:44060178-44060200 CACGTTGTTACGGGATCCTTGGG + Intergenic
1157905100 18:51562740-51562762 CACTTTATTATGGCAGCCCTGGG + Intergenic
1158015395 18:52777199-52777221 CAGTTTGTTATGGCAGCCATAGG - Intronic
1158713177 18:59855062-59855084 CACTTTGTTGTGGCAGCCCCAGG + Intergenic
1159154850 18:64570350-64570372 CACTTTGTTGATCCATCTTTGGG - Intergenic
1159267899 18:66108169-66108191 TACTTTGTTATGGCAGCCATGGG + Intergenic
1160328039 18:77968465-77968487 CACCTTGTTATGACAGCCTTAGG + Intergenic
1160333144 18:78013814-78013836 CACTTTGGTACGGCATCCCTAGG + Intergenic
1160352762 18:78198962-78198984 CAGTTTGTTGTGGCAACCTTAGG - Intergenic
1161177570 19:2855623-2855645 TACTTTGTTATGGCAGCCCTGGG - Exonic
1161981954 19:7634474-7634496 CACTTTGTTCTGGCAGGCCTAGG - Intronic
1163025231 19:14507114-14507136 CAGTTTGTTGTGGCAGCCCTAGG + Intergenic
1163374927 19:16924216-16924238 CATTTTGTTGTGGCAGTTTTAGG + Intronic
1164713276 19:30374661-30374683 CAGTTTGTTGTGTTTTCCTTGGG - Intronic
1167592810 19:50413626-50413648 CACTCTCCTGTTGCATCCTTGGG + Intronic
925491606 2:4401206-4401228 TAATTTGTTATGGCAACCTTAGG + Intergenic
925549577 2:5057351-5057373 CATTTTGTTTTGGCTTCCTGGGG + Intergenic
925630562 2:5888675-5888697 TACTTTGTTCTGGCAGCCCTAGG - Intergenic
925645579 2:6032562-6032584 GCCTTTGTTGTGGCATTCTGCGG + Intergenic
925818403 2:7775837-7775859 CATTTAGTTGTGGCAAACTTGGG + Intergenic
926211118 2:10870166-10870188 TGATTTGTTGTGGCAGCCTTAGG + Intergenic
926491967 2:13535804-13535826 CCATTTGTTATGGCAGCCTTAGG - Intergenic
926767569 2:16335705-16335727 CAGTTTGCTGTGGGATCCTCAGG - Intergenic
927178854 2:20429491-20429513 TACTTTGTTATGGCAGCCCTAGG - Intergenic
928066122 2:28166199-28166221 TACTTTGTTATGGCAGCCCTAGG + Intronic
929180335 2:39031141-39031163 TACTTTGCTGTGGCAGCCTTAGG + Intronic
929369459 2:41204705-41204727 CTCCTTGATGTGGCATCGTTTGG - Intergenic
929397041 2:41534856-41534878 TACTTTGTTATGGCAGCCCTAGG + Intergenic
929730032 2:44479128-44479150 CAGTTTCTTGTGGCATTCTTAGG - Intronic
930256551 2:49099905-49099927 TACTTTATTGTGGCATCTCTAGG + Intronic
931046655 2:58361780-58361802 CACTTTGTTATAGCAACCCTAGG - Intergenic
931122501 2:59235532-59235554 CAATTTGTTATGGCAGCCCTAGG - Intergenic
932016916 2:68037955-68037977 TACTTTGTTATGGCAGCCCTAGG - Intergenic
932638164 2:73411431-73411453 CACTTTGTTATAGCAGCCCTAGG + Intronic
932799020 2:74723064-74723086 TACTTTGTTATGGCAGCCATAGG - Intergenic
932871465 2:75403581-75403603 TAGTTTGTTGTGGCAGCCCTAGG - Intergenic
933180717 2:79223366-79223388 TACTTTGTTATGACATCCTGGGG + Intronic
933481757 2:82867049-82867071 CACTTTGTTATAGCAGCCCTGGG - Intergenic
933869831 2:86555373-86555395 TACTTTGTTATGGCAGCCTCAGG - Intronic
934242293 2:90280403-90280425 CAAATGGATGTGGCATCCTTGGG + Intergenic
935069415 2:99680916-99680938 CACTGTGTTATGCCATCCTCAGG - Intronic
936936468 2:117843556-117843578 CAATTTTTTGTGGATTCCTTAGG + Intergenic
937023021 2:118675899-118675921 CACTTTGTTATAGCAACCCTGGG + Intergenic
937178380 2:119966111-119966133 CACTTTGTTGTGTCATTCTCTGG + Intronic
937728515 2:125197053-125197075 TAATTTATTGTGGCATCCCTAGG + Intergenic
938025860 2:127947292-127947314 TACTTTGTTATGGCAACCCTAGG + Intronic
938043556 2:128096310-128096332 TACTTTGTTGTGGTAGCCCTAGG - Intronic
938091885 2:128439883-128439905 CACTTTGTTCTGGCAGCCCGAGG + Intergenic
939806344 2:146779283-146779305 CACTTTGTTCTTGGACCCTTTGG - Intergenic
941197220 2:162467889-162467911 CACCTTCTTGTTGCATCCTCAGG + Intronic
941957381 2:171218659-171218681 CACCTTGTTGCTGCATCCTCTGG + Intronic
942870725 2:180731419-180731441 CACCTTGTTGTTGCATTCTCTGG - Intergenic
943028547 2:182658114-182658136 TACTTTGTTATGGCAGCCCTAGG - Intergenic
943055628 2:182974770-182974792 TACTTTGTTATGGCAGCCCTAGG + Intronic
943265482 2:185726422-185726444 CAATTTGTTATGGCAACCCTAGG - Intergenic
944445067 2:199780752-199780774 CAATTTGCTGTGGCATCTCTTGG - Intronic
945831851 2:214796673-214796695 TTCTTTGTTATGGCAGCCTTAGG + Intronic
945937583 2:215918642-215918664 CACCTTGTTCTGGCTGCCTTGGG - Intergenic
947327090 2:228991420-228991442 CACATTGTTGCAGGATCCTTGGG + Intronic
948214396 2:236217796-236217818 CAGTTTGATGTGGAGTCCTTTGG + Intronic
948286539 2:236790256-236790278 TACTTTGTTATGGCAGCCCTGGG + Intergenic
948341272 2:237254179-237254201 GAGTTTGTTGTGGCATCTTGGGG - Intergenic
1169395507 20:5225361-5225383 TACTTTGTTATGGCAGCCCTGGG + Intergenic
1169408724 20:5348833-5348855 TACTTTGTTGCAGCAGCCTTTGG + Intergenic
1169447799 20:5687067-5687089 CACTTTGTTATGGCAGCCCTGGG - Intergenic
1169475997 20:5931728-5931750 CACATTGTTATGGCAGCCCTAGG + Intergenic
1169697843 20:8411068-8411090 CAATTTGTTATGGCAGCCTCAGG + Intronic
1169898187 20:10526570-10526592 CAATTTGTTATGTCATCCATAGG - Intronic
1170091779 20:12597101-12597123 TACTTTGTAATGGCAGCCTTAGG - Intergenic
1170772715 20:19348084-19348106 CACCTTGTTGTGACCTGCTTGGG - Intronic
1171115208 20:22519506-22519528 CACTTTGCTGTGAACTCCTTCGG - Intergenic
1172557727 20:35857041-35857063 AACTTTGTTGTTGCATTCTTCGG + Intronic
1172893898 20:38286181-38286203 CATTTTGTTATGGCAGCCCTAGG - Intronic
1173680938 20:44881325-44881347 CCCTTTGTTATGGCAGGCTTAGG - Intergenic
1175236992 20:57521193-57521215 CACTTTGTCATGGCGTCCCTGGG + Intronic
1175560634 20:59926237-59926259 CACTTTGTTAAGGCAACCCTAGG - Intronic
1177239085 21:18432790-18432812 CACTTTGTTTAGGCAACCCTAGG + Intronic
1177376839 21:20281231-20281253 GACTTTGAATTGGCATCCTTAGG + Intergenic
1177504766 21:22006200-22006222 CACCTTGTTGTTGCATCCTTTGG + Intergenic
1177613345 21:23483533-23483555 TAGTTTTTTGTGGAATCCTTGGG - Intergenic
1178148788 21:29769895-29769917 TACTTTGTTATGGCAGTCTTAGG + Intronic
1178246555 21:30958442-30958464 GACTTTGTTGTTTCATCCCTGGG - Intergenic
1178250265 21:30997172-30997194 TAATTTGTTATGGCAGCCTTAGG - Intergenic
1178308641 21:31511206-31511228 CACTTTGTTAGGGCAACCCTAGG + Intronic
1178712024 21:34925698-34925720 TACTTTGTTATGGCAGCCCTAGG + Intronic
1179119256 21:38527904-38527926 CACTTTGTTATGGCACCCCTGGG - Intronic
1179178236 21:39023791-39023813 TACTTTGTTGTGGCAGCCCCAGG - Intergenic
1179487212 21:41718027-41718049 TACTTTGTTATGGCATCCACAGG - Intergenic
1180442609 22:15381391-15381413 CACTGTGTTCTGGAATCCTGAGG + Intergenic
1182897441 22:33870341-33870363 CAGTTTGTTATGGCAGCCTTCGG + Intronic
1183276082 22:36899082-36899104 TACTTTGTTCTGGCAGCCCTAGG - Intergenic
1183911009 22:41079296-41079318 CAGTTTCTTTTGCCATCCTTTGG + Intergenic
1183930548 22:41233741-41233763 CATTTTGTTGTGGCAGTCCTAGG + Intronic
949602292 3:5613379-5613401 CCCTTTGTGGTGGCATGGTTTGG + Intergenic
949787472 3:7757807-7757829 CAATTTGTTATAGCAGCCTTAGG + Intergenic
950367482 3:12497789-12497811 TACTTTGTTATGGCAGCCCTAGG - Intronic
950963905 3:17132794-17132816 CACTTTGTTGCTGCATCCTCAGG - Intergenic
951097056 3:18644568-18644590 CAGTTTGATGTGGCCTCCTGTGG - Intergenic
951718300 3:25672870-25672892 CACAGTGTTATGGGATCCTTGGG + Intergenic
951754636 3:26076706-26076728 TACTTTGTTGTGGCAGCCCTAGG + Intergenic
952555993 3:34531996-34532018 CACTATCATGTGGCATCCTGAGG + Intergenic
952676348 3:36035749-36035771 AACTTTTTGGTGGCATCTTTAGG + Intergenic
953893661 3:46776610-46776632 CATTTTCTTGTGGCATCGTTAGG - Intronic
954811302 3:53249997-53250019 GACTTTGTCGTGGCTTCCTATGG - Intronic
955006779 3:54975962-54975984 CCATTTGTTGTGGTTTCCTTTGG + Intronic
956392795 3:68791543-68791565 CACTTTGTTATGGCATCCTTAGG + Intronic
956694146 3:71904388-71904410 TACTTTGTTATGGCACCCCTGGG + Intergenic
956944019 3:74198167-74198189 CACTTTGTTACAGCAGCCTTAGG + Intergenic
957060992 3:75481219-75481241 TACTTGGTTGTGGCAGCCCTGGG + Intergenic
958258229 3:91349341-91349363 CACTTTGTTTTGGCAGCGTGAGG - Intergenic
959873475 3:111354726-111354748 CACTTTGTTATGGTAGCCCTAGG + Intronic
960137488 3:114120699-114120721 CATTTTGTTATGGCAACCCTAGG + Intergenic
960511691 3:118556770-118556792 TACTTTGTTATGGCAGCCTCAGG + Intergenic
961415318 3:126752644-126752666 CCCTTTGTTGTGGCTGCCCTGGG + Intronic
962218537 3:133543367-133543389 GACTTTGTTATGGCAGCCTTGGG - Intergenic
962662823 3:137621556-137621578 TTCTTTGTTATGGCAGCCTTAGG - Intergenic
963768374 3:149362695-149362717 GACTTTGTTTTGGCAGCCCTAGG + Intergenic
965192887 3:165554324-165554346 CACTTTGTAATGGCATGTTTAGG - Intergenic
965459631 3:168946001-168946023 TACTTTGTTATGGCAGCCCTAGG - Intergenic
965633224 3:170754963-170754985 TACTTTGTTATGGCAGCCCTTGG + Intronic
965697006 3:171419557-171419579 CTCTTTGTTTTTTCATCCTTAGG - Intronic
965751400 3:171978376-171978398 TACTTTGTTATGGCAGCTTTAGG - Intergenic
965845678 3:172958588-172958610 TACTTTGTTGTAGCAACCCTAGG - Intronic
966112540 3:176419862-176419884 TACTTTGTTTTGGCAGACTTAGG + Intergenic
966158292 3:176942180-176942202 CACATTGTTGTTTCATCTTTAGG + Intergenic
966678019 3:182610259-182610281 CTCTTTGTTCTAGCATTCTTTGG - Intergenic
966865872 3:184259052-184259074 CATTATGATGTGGCCTCCTTGGG - Intronic
968181008 3:196595239-196595261 TACTTTGCTGTGGCAACCCTAGG + Intergenic
968593127 4:1469552-1469574 CACTTTGTTATGGCAGCCACAGG - Intergenic
969004899 4:4011254-4011276 TACTTGGTTGTGGCAGCCCTAGG + Intergenic
969110328 4:4840325-4840347 TACTTTGTTATGTCATCCCTAGG - Intergenic
969381145 4:6798944-6798966 TACTTTGTTGTAGCATCCCTAGG - Intronic
969631312 4:8340066-8340088 CAGTTTTTTGAGGCATCTTTGGG + Intergenic
969747975 4:9088889-9088911 TACTTGGTTGTGGCAGCCCTAGG - Intergenic
969809004 4:9633427-9633449 TACTTGGTTGTGGCAGCCCTAGG - Intergenic
970016519 4:11518142-11518164 TACTTTGTTATGGCAGCCCTAGG + Intergenic
970229865 4:13898566-13898588 CACTTTGTTATGGCAGCCCTAGG + Intergenic
970880926 4:20929638-20929660 CAGTTTTTTGTGGAATCTTTAGG - Intronic
971225850 4:24750925-24750947 CACTTTGTTAGGGCAGCCCTAGG + Intergenic
971508227 4:27389949-27389971 CAATTTGTTATGGCAACCCTAGG + Intergenic
971750788 4:30645176-30645198 TACTTTGTTATGGCATCCCTGGG + Intergenic
972822939 4:42723218-42723240 CAGTTTGTTATGGCAGCCCTAGG - Intergenic
973003762 4:44985384-44985406 CAGTTTCTTGTGGCGTCCTTTGG - Intergenic
973211043 4:47615796-47615818 TACTTTGTTATGGCAGCCCTAGG + Intronic
973971394 4:56217157-56217179 TACTTTGTTAGGGCATCCCTAGG - Intronic
974020904 4:56691471-56691493 TACTTTGTTATGGCAGCCCTAGG - Intergenic
974748366 4:66104906-66104928 CAATTTGTTATGGCATCCTTAGG + Intergenic
974836963 4:67262724-67262746 TACTTTGTTGTGTCAGCCCTAGG - Intergenic
975145165 4:70958963-70958985 CACTTGGCAGTGGCAACCTTCGG + Exonic
975241575 4:72066155-72066177 CACCTTGTTGCTGCATCCTCTGG + Intronic
975241835 4:72068297-72068319 CACCTTGTTGCTGCATCCTCTGG + Intronic
975319313 4:72992780-72992802 GACTTTGTTATGGCAGCCCTAGG - Intergenic
976196597 4:82537961-82537983 TAATTTGTTGTGGCAGCCCTTGG + Intronic
976432456 4:84978599-84978621 CACTTTGTTATGGCAGCCCTAGG + Intergenic
976929804 4:90551972-90551994 CACCTTGATGTTGCATCCTCTGG + Intronic
977059515 4:92239779-92239801 CACTTTGTTATGGTAATCTTAGG - Intergenic
977336173 4:95702208-95702230 CACTTTGTTATGGCAGCCCTAGG + Intergenic
977415358 4:96725961-96725983 TACTTTCTTATGGCACCCTTAGG + Intergenic
977870911 4:102089431-102089453 CACTTTGTTATGGCAGCCCTAGG + Intergenic
977882708 4:102223925-102223947 CTCTGTTTTGTGGCATACTTTGG + Intergenic
978726322 4:111973814-111973836 CACTTTCTGGAGGAATCCTTAGG + Intergenic
979519022 4:121644868-121644890 CACTTTGTGGTGGGATGCTCAGG + Intergenic
979547483 4:121953954-121953976 TACTTTGTTGTGGCAGCCTCAGG - Intergenic
980377393 4:131967588-131967610 CAATTTGTTGTGGTAGCCTAGGG + Intergenic
981306041 4:143247914-143247936 CACCTTGTTGTTGCACCCTTGGG + Intergenic
982314711 4:154020524-154020546 TACTTTGTTCTGGCAGCCCTTGG - Intergenic
982512539 4:156301076-156301098 AACTTTATTTTGCCATCCTTAGG + Intergenic
983078454 4:163355029-163355051 TGCTTTGTTTTGGCAGCCTTTGG - Intergenic
983739211 4:171106918-171106940 CATTTCTTTGTGGTATCCTTAGG - Intergenic
983781177 4:171672665-171672687 CACTTTGTTACGGCAGCCCTAGG - Intergenic
984702381 4:182826517-182826539 CACTTTGTTAAGGCAGCCCTAGG - Intergenic
985063542 4:186101164-186101186 CACTTTGTTATGGCAATCCTAGG - Intergenic
985715069 5:1452577-1452599 TATTTTGTTGTGGCAGCCTGAGG + Intergenic
986406160 5:7426982-7427004 TACTTTGTTCTGGCAGCCCTGGG - Intronic
986932239 5:12840449-12840471 CAATTTGTGGTGGCAGCCCTAGG - Intergenic
987256875 5:16163976-16163998 GACTTTGTTGCTGCATCCTCTGG - Intronic
987517963 5:18939001-18939023 CATTGTTTTTTGGCATCCTTTGG - Intergenic
987565240 5:19575687-19575709 CAATTTGTTATGTCATCCCTAGG - Intronic
988163455 5:27551643-27551665 CACTTTGTTTTGGCAGCAGTGGG + Intergenic
988650393 5:33142527-33142549 CACTTTCTTACAGCATCCTTAGG + Intergenic
988865677 5:35331807-35331829 GACTTTGTTATGGCAGCCCTAGG + Intergenic
989426309 5:41299995-41300017 CAATTTGTTATGGAAGCCTTGGG + Intergenic
989954256 5:50338262-50338284 CACCTTGTTGCTGCATCCTCTGG + Intergenic
990909608 5:60840575-60840597 TACTTTGTTATGGCAGCCTGAGG + Intronic
991971226 5:72143636-72143658 TACTTTGTTATGGCAGCCCTGGG - Intronic
992475061 5:77093957-77093979 TACTTTGTTGTGGCAGCTCTAGG - Intergenic
992588208 5:78263393-78263415 CAGTTTTTTGTGGAATCTTTAGG + Intronic
993176286 5:84490109-84490131 TAATTTGTTGTGGCAGCTTTAGG - Intergenic
993466202 5:88249930-88249952 AACTTTGTTGTGGGTTCCTGAGG - Intronic
993948037 5:94138345-94138367 CAGTCTGTTGTGGCTTCCCTTGG + Intergenic
994130635 5:96223671-96223693 TACTTTGTTATGGCAGCCCTAGG + Intergenic
994156877 5:96513762-96513784 TACTTTGTTATGGCAACCCTAGG - Intergenic
995000454 5:107121371-107121393 CACTTAGTTTTGGCACCCTGAGG - Intergenic
995380355 5:111524763-111524785 CACTTTGATGCTGCATCCTCTGG - Intergenic
996303391 5:122016893-122016915 TACTTTGTTATGGCAGCCTTAGG - Intronic
996889343 5:128399329-128399351 CATTGTGTTCTGGCATCCATTGG - Intronic
997438900 5:133894986-133895008 TACTTTGTCATGGCATCCATAGG - Intergenic
997669261 5:135656962-135656984 TACTTTGTTATGGCAGCCCTAGG + Intergenic
998560846 5:143170302-143170324 CACTGGGTGGTGGCATCTTTTGG + Intronic
998733433 5:145107333-145107355 GACTTTGTTATGGCAACCATAGG - Intergenic
999441027 5:151600955-151600977 CAGCTTGTTGTTGCATCCTCCGG - Intergenic
1001750421 5:174125976-174125998 CACTTTGTTAAGGCAGCCTTAGG + Intronic
1002556993 5:180050003-180050025 TACTTTGTTCTGGCAGCCCTAGG - Intronic
1002577329 5:180181757-180181779 CACTTTGTTAAGGCAGCCCTAGG + Intronic
1002638787 5:180620805-180620827 CGCTTTCTTGTGGCCACCTTGGG - Intronic
1002676699 5:180921062-180921084 CAGTTTTTTGTGGAATCTTTAGG - Intronic
1004105434 6:12663627-12663649 CAATTTGTTATGGCAGCCCTAGG - Intergenic
1004388739 6:15191549-15191571 TAGTTTGTTGTGGCAGCCCTAGG - Intergenic
1004921869 6:20383421-20383443 TACTTTGTGATGGCACCCTTAGG - Intergenic
1004957995 6:20751294-20751316 TAATTTGTTATGGCAGCCTTAGG - Intronic
1005223770 6:23618709-23618731 CACTTTTTTTTTGTATCCTTAGG - Intergenic
1005759287 6:28952942-28952964 CAATTTGTTGTGGCAGCCCTAGG - Intergenic
1006096198 6:31658336-31658358 CACTTTGTAGTGGTATATTTAGG + Exonic
1006469433 6:34218766-34218788 CACTTTGTTATGACAGCCCTAGG + Intergenic
1006961772 6:37939123-37939145 CAATTTGTTGTGGCAACCCTAGG - Intronic
1007069831 6:39028253-39028275 TACTTTGTTATGACAGCCTTTGG - Intronic
1008225531 6:48910410-48910432 TACTTTGTTCTGGCAGCCCTAGG + Intergenic
1008997026 6:57671368-57671390 CACTTTGTTTTGGCAGCGTGAGG + Intergenic
1009185541 6:60570697-60570719 CACTTTGTTTTGGCAGCATGAGG + Intergenic
1010082581 6:71881510-71881532 TACTTTGTTATGGCAGCCCTAGG - Intergenic
1010124150 6:72412966-72412988 TACTTTGTTGTGGCAGCCCCCGG - Intergenic
1010341290 6:74755618-74755640 CAAATTGTTATGGGATCCTTGGG - Intergenic
1010913250 6:81585173-81585195 TACTTTGTTATGGCAATCTTAGG + Intronic
1011126191 6:84010423-84010445 GACTTTGTTATGGCAGCCCTAGG + Intergenic
1011523199 6:88233382-88233404 AACTTTTTGGTGGCATCTTTAGG - Intergenic
1011592317 6:88982140-88982162 CCCTCAGTTCTGGCATCCTTGGG + Intergenic
1011709524 6:90038105-90038127 TACTTTGTTATGGAAGCCTTAGG + Intronic
1011735691 6:90308839-90308861 CACTCTGTTCTGCCATCCTGGGG - Intergenic
1011846916 6:91576298-91576320 TACTTTGTTATGGCAGCCATGGG + Intergenic
1012733654 6:102911499-102911521 CACTTTGCTGGGGCAGCCTCAGG - Intergenic
1013091922 6:106907924-106907946 CACTTTGTTATGACAGCCCTAGG + Intergenic
1013387066 6:109642249-109642271 CACTTTGTTATGGCAACCCCAGG + Intronic
1013960887 6:115898788-115898810 TACTTTGTTCTGGCAGCCCTAGG - Intergenic
1014234419 6:118938621-118938643 TACTTTGTTATGGCAGCCCTGGG + Intergenic
1014253997 6:119143154-119143176 TACTTTGTTGAGGCATCTCTAGG + Intronic
1014550269 6:122782219-122782241 TACTTTGTTGTGGCAGCCTTAGG - Intronic
1015300725 6:131650563-131650585 TACTTTGTCATGGCAGCCTTAGG - Intronic
1015337199 6:132053382-132053404 TACTTTGTTATAGCATCCTGAGG + Intergenic
1015552863 6:134430451-134430473 CATTTTGTTATGGCAGGCTTAGG - Intergenic
1015798081 6:137033030-137033052 TACTTTGTTTTGGCAGCCCTAGG - Intronic
1016231462 6:141810310-141810332 CACTTAGTTATGGCAGCTTTGGG + Intergenic
1016618007 6:146075592-146075614 TACTTTGTTATGGCAACCCTAGG - Intronic
1016793665 6:148094657-148094679 CAGTTTTTTGGGGCATCTTTAGG - Intergenic
1017284395 6:152657900-152657922 TACTTTGTTCTGGCAGCCCTAGG - Intergenic
1018214701 6:161515473-161515495 CATTTGGTTGTGGGATGCTTAGG + Intronic
1018316028 6:162557381-162557403 CACTTTGCTGTGGCCTCACTGGG + Intronic
1019968593 7:4522002-4522024 TACTTTGTTATGGCAGCCTTAGG + Intergenic
1020325028 7:6967744-6967766 TACTTGGTTGTGGCAGCCCTAGG + Intergenic
1020886222 7:13822141-13822163 TACTTTGTTATGGCACCCATAGG - Intergenic
1021438118 7:20645121-20645143 CACTCTGGTATCGCATCCTTTGG - Intronic
1021463507 7:20915039-20915061 TACTTTGTTATGGCAGCCCTAGG + Intergenic
1021772677 7:24021088-24021110 TATTTTGTTATGGCAGCCTTAGG + Intergenic
1021866820 7:24966390-24966412 CACTTGTTTGTGGCATCCAGAGG - Intronic
1024123207 7:46266297-46266319 CATTTTGCTGTGGCTTTCTTGGG + Intergenic
1024833160 7:53485305-53485327 CACTTTGTTATGGCAGCCCTGGG - Intergenic
1024954211 7:54899338-54899360 GATTTTGCTGTGGCATCCTTGGG + Intergenic
1025062558 7:55823237-55823259 CACATTGTTGTGCCCACCTTTGG + Intronic
1027147794 7:75709568-75709590 GACTTTTTGGTGGTATCCTTAGG + Intronic
1027835742 7:83239104-83239126 GACTTTGTTGTTGGATCCTCAGG - Intergenic
1028746226 7:94329457-94329479 CACTTTGTCGTGGGTTTCTTTGG + Intergenic
1028954082 7:96669149-96669171 TACTTTGTTATGGCAGCCCTAGG + Intronic
1029334826 7:99889720-99889742 CAGTTTGTTATGGCCACCTTAGG - Intronic
1029907563 7:104106907-104106929 CACATTGTTATGGCATCCTTGGG - Intergenic
1030284376 7:107810686-107810708 TACTTTGTTATGGCAACCCTAGG - Intergenic
1030302542 7:107988927-107988949 CACTTTGTTATGGCATCCCTAGG + Intronic
1030930407 7:115516693-115516715 CAATTTGTTATGGCAGACTTAGG + Intergenic
1031914934 7:127554093-127554115 TACTTTGTTGTGGCAGCCCTGGG - Intergenic
1031943640 7:127815766-127815788 TACTTTGTTATGGCAGCCCTAGG + Intronic
1032753133 7:134862803-134862825 TACTTTGTTATGGCAGCCCTAGG - Intronic
1032825479 7:135564049-135564071 CTCTTTGTTGCGGCTACCTTTGG + Intronic
1033123890 7:138690193-138690215 TACTTTGTTATGGCAGCCCTAGG + Intronic
1033702046 7:143848782-143848804 CAGTTTTTTGTGGAATCTTTAGG - Intergenic
1034006002 7:147472991-147473013 CTCTGAGTTCTGGCATCCTTAGG - Intronic
1034249838 7:149680353-149680375 CAGTTTTTTGTGGAATCTTTAGG + Intergenic
1034509765 7:151524156-151524178 CACTTTGTTATGGCAGCTATAGG + Intergenic
1034923352 7:155101601-155101623 TAATTTGTTATGGCAGCCTTGGG - Intergenic
1035075802 7:156176572-156176594 CACTTTGTTATGGCAGCCCCAGG + Intergenic
1036371035 8:8163085-8163107 TACTTGGTTGTGGCAGCCCTAGG - Intergenic
1036879862 8:12502551-12502573 TACTTGGTTGTGGCAGCCCTAGG + Intergenic
1037131718 8:15414497-15414519 TACTTTGTTATAGCAGCCTTAGG - Intergenic
1037313577 8:17580678-17580700 TACTTTGTTATGGCAGCCCTAGG - Intronic
1037535624 8:19821173-19821195 TACTTTGTTATGGCAACCCTAGG - Intronic
1038681189 8:29670076-29670098 TACTTTGTTATGGCATCCCTAGG - Intergenic
1039338198 8:36618142-36618164 AACTTTTTGGTGGCGTCCTTAGG + Intergenic
1039758228 8:40545803-40545825 TACTTTGTTATGGCAGCCCTAGG + Intronic
1041436355 8:57846257-57846279 TACTTTGTTGTGGCAACTCTAGG - Intergenic
1041774868 8:61512601-61512623 TAATTTGTTGTGGCAGCCTTAGG + Intronic
1042646511 8:70992973-70992995 CCCTTTGTTCTGGCAGCCCTAGG + Intergenic
1042746785 8:72117199-72117221 CAATTTGTTATGGCAGCCCTAGG - Intronic
1043565078 8:81538750-81538772 CAATTTGTTGTGGCAACCCCAGG + Intergenic
1043647470 8:82538398-82538420 CTCTTTCCTGTGGCATCTTTGGG - Intergenic
1044009571 8:86976917-86976939 AACTTTTTTTTGGAATCCTTAGG + Intronic
1044201794 8:89446873-89446895 TAATTTGTTATGGCAACCTTAGG - Intergenic
1046236438 8:111429351-111429373 TACTTTGTTTTGGGAACCTTCGG + Intergenic
1046355572 8:113081152-113081174 TATTTTGTTATGGCATCTTTAGG - Intronic
1046436362 8:114194526-114194548 TACTTTGTTATGGCAGCCCTAGG - Intergenic
1046661836 8:116955935-116955957 CAATTTGTTATGGCATCCGTAGG + Intronic
1046912037 8:119639030-119639052 CACTTTCATGTGGTATCCTCTGG + Intronic
1047316938 8:123743166-123743188 CACTTTGTTATGACAGCCCTAGG + Intergenic
1047388003 8:124427277-124427299 CCATTTGTTATGGCAGCCTTAGG - Intergenic
1047564677 8:126031004-126031026 CTCCTTGATGTGGAATCCTTGGG - Intergenic
1047959163 8:129998377-129998399 CACTTCCTTGTGGAATCCTCAGG - Intronic
1048527287 8:135214650-135214672 CATTTTGTTGTGGCAACTCTAGG + Intergenic
1048653279 8:136505213-136505235 TAGTTTGTTGTGGCATCCTTAGG - Intergenic
1050032365 9:1400057-1400079 CACTTTGTTAAGGCATCACTAGG - Intergenic
1051037850 9:12770485-12770507 TACTTTGTTATGGCAACCCTAGG + Intergenic
1051555034 9:18373669-18373691 CTCTTTGGTGTGGCATGGTTAGG - Intergenic
1051724659 9:20076639-20076661 CACTTTGTTGTGGGAGCCCTAGG + Intergenic
1052266306 9:26577561-26577583 CACTTTGTTTTCCCATTCTTTGG + Intergenic
1053619834 9:39803592-39803614 CACTTTTTTATGGCAGCCCTAGG - Intergenic
1053878014 9:42562907-42562929 CACTTTGTTATGGCAGCCCTAGG - Intergenic
1053894650 9:42731458-42731480 CACTTTGTTATGGCAGCCCTAGG + Intergenic
1054233681 9:62538787-62538809 CACTTTGTTATGGCAGCCCTAGG + Intergenic
1054264323 9:62903851-62903873 CACTTTGTTATGGCAGCCCTAGG + Intergenic
1055439563 9:76324806-76324828 CACTCTGTTGAGGCAGCCTGAGG + Intronic
1056592941 9:87978677-87978699 CAGTTTTTTGTGGCATATTTAGG - Intergenic
1057031958 9:91782915-91782937 GGCTTTGTTGTGGCTGCCTTAGG - Intronic
1057300613 9:93879700-93879722 GTCTTTGTTGTCTCATCCTTAGG - Intergenic
1058082749 9:100716800-100716822 TACTTTGTTATGGCAGCCCTAGG - Intergenic
1058660811 9:107266895-107266917 TAATTTGGTGTGACATCCTTAGG - Intergenic
1059880748 9:118686158-118686180 CACTTTGTTGTGGAAGCTCTAGG + Intergenic
1059977529 9:119733789-119733811 CAAGTTTTTGTGGAATCCTTAGG - Intergenic
1060259415 9:122060905-122060927 TAATTTGTTATGGCAGCCTTAGG - Intronic
1060395000 9:123309904-123309926 TACTTTGTTATGGCAGCCCTGGG + Intergenic
1061657873 9:132106741-132106763 CACCTTATTGTTGCATCCTCCGG + Intergenic
1062737428 9:138145016-138145038 CACTTTGTTACGGCAGCCCTAGG - Intergenic
1203790242 EBV:147608-147630 CCCTTTATTGTGGCATCCTAAGG + Intergenic
1186711546 X:12203049-12203071 TAATTTGTTATGGCATCCATGGG + Intronic
1186897371 X:14017500-14017522 TACTTTGTTATGGCAGCCCTAGG - Intronic
1186903100 X:14079319-14079341 TACTTTGTTATGGCAGCCCTAGG + Intergenic
1187548240 X:20274553-20274575 TACTTTGTTATGGCAGCCCTTGG + Intergenic
1188084678 X:25888787-25888809 TACTTTGTTATGGCAGCCCTCGG + Intergenic
1188290638 X:28383585-28383607 TACTTTGTTATGGCAGCCCTAGG - Intergenic
1188457718 X:30386177-30386199 CAATTTGTTGTGGTAGACTTCGG + Intergenic
1188832061 X:34910932-34910954 TAGTTTTTTGTGGCATCTTTAGG + Intergenic
1189158561 X:38785955-38785977 TACTTTGTTATGGCATCCCTAGG + Intergenic
1189248647 X:39582608-39582630 TACTTTGTTATGGCAGCCCTGGG - Intergenic
1189380098 X:40496502-40496524 CACCTTGTTGCTGCATCCTCTGG - Intergenic
1190430574 X:50374490-50374512 TACTTTGTTATGGCAGCCTTAGG + Intronic
1190461841 X:50684486-50684508 CACTTTGTTGTGACATCCCTAGG + Intronic
1191972842 X:66836971-66836993 CATTTTCTTTTGGCATCTTTAGG - Intergenic
1192495426 X:71613812-71613834 TAATTTGTTGTGGCAACCATAGG - Intergenic
1192887991 X:75357447-75357469 TGCTTTCTTGTGGAATCCTTCGG + Intergenic
1193199613 X:78673195-78673217 TAATTTGTTATGGCATCCCTAGG + Intergenic
1193213039 X:78829847-78829869 TACTTTGTTATGGCAGCCATAGG + Intergenic
1193838491 X:86377210-86377232 CCCTTTGTTCTGGAATGCTTAGG + Intronic
1195302088 X:103540187-103540209 TAATTTGTTGTGGCAACCCTAGG - Intergenic
1197342373 X:125288714-125288736 CACACTGTTATGGGATCCTTGGG - Intergenic
1197701256 X:129601788-129601810 CACTTTGCTGTGCCATCTTCTGG - Intergenic
1197705570 X:129632209-129632231 CACCTTGTTGCTGCATCCTCTGG - Intergenic
1198419826 X:136460011-136460033 CAATTTGTTATGGCAGCCCTGGG + Intergenic
1198659262 X:138949199-138949221 TAATTTGTTATGGCAGCCTTAGG - Intronic
1199903822 X:152204749-152204771 TACTTTGTTATGGCAGCCCTAGG - Intronic
1199920387 X:152396377-152396399 CACTTTGTTGTGGCATCCTTGGG + Intronic
1200815860 Y:7531699-7531721 CTCTGTGTTATGACATCCTTAGG + Intergenic