ID: 1199925885

View in Genome Browser
Species Human (GRCh38)
Location X:152463572-152463594
Sequence GCTTCAGTTACCTATACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199925885_1199925889 29 Left 1199925885 X:152463572-152463594 CCAAAAGTATAGGTAACTGAAGC No data
Right 1199925889 X:152463624-152463646 TGAAAAGCTTCTTCACAGAAAGG No data
1199925885_1199925886 -10 Left 1199925885 X:152463572-152463594 CCAAAAGTATAGGTAACTGAAGC No data
Right 1199925886 X:152463585-152463607 TAACTGAAGCAAAAATACATAGG No data
1199925885_1199925887 -7 Left 1199925885 X:152463572-152463594 CCAAAAGTATAGGTAACTGAAGC No data
Right 1199925887 X:152463588-152463610 CTGAAGCAAAAATACATAGGTGG No data
1199925885_1199925888 -6 Left 1199925885 X:152463572-152463594 CCAAAAGTATAGGTAACTGAAGC No data
Right 1199925888 X:152463589-152463611 TGAAGCAAAAATACATAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199925885 Original CRISPR GCTTCAGTTACCTATACTTT TGG (reversed) Intergenic
No off target data available for this crispr