ID: 1199925888

View in Genome Browser
Species Human (GRCh38)
Location X:152463589-152463611
Sequence TGAAGCAAAAATACATAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199925885_1199925888 -6 Left 1199925885 X:152463572-152463594 CCAAAAGTATAGGTAACTGAAGC No data
Right 1199925888 X:152463589-152463611 TGAAGCAAAAATACATAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199925888 Original CRISPR TGAAGCAAAAATACATAGGT GGG Intergenic
No off target data available for this crispr