ID: 1199932328

View in Genome Browser
Species Human (GRCh38)
Location X:152536164-152536186
Sequence CTCTTCAACTATTTCCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199932328_1199932335 17 Left 1199932328 X:152536164-152536186 CCTGATGGGAAATAGTTGAAGAG No data
Right 1199932335 X:152536204-152536226 GACTGAAGACAGCTAGTACGGGG No data
1199932328_1199932333 15 Left 1199932328 X:152536164-152536186 CCTGATGGGAAATAGTTGAAGAG No data
Right 1199932333 X:152536202-152536224 AGGACTGAAGACAGCTAGTACGG No data
1199932328_1199932334 16 Left 1199932328 X:152536164-152536186 CCTGATGGGAAATAGTTGAAGAG No data
Right 1199932334 X:152536203-152536225 GGACTGAAGACAGCTAGTACGGG No data
1199932328_1199932332 -5 Left 1199932328 X:152536164-152536186 CCTGATGGGAAATAGTTGAAGAG No data
Right 1199932332 X:152536182-152536204 AAGAGGAATTGGGAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199932328 Original CRISPR CTCTTCAACTATTTCCCATC AGG (reversed) Intergenic
No off target data available for this crispr