ID: 1199932332

View in Genome Browser
Species Human (GRCh38)
Location X:152536182-152536204
Sequence AAGAGGAATTGGGAAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199932328_1199932332 -5 Left 1199932328 X:152536164-152536186 CCTGATGGGAAATAGTTGAAGAG No data
Right 1199932332 X:152536182-152536204 AAGAGGAATTGGGAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199932332 Original CRISPR AAGAGGAATTGGGAAAAAAA AGG Intergenic
No off target data available for this crispr