ID: 1199932333

View in Genome Browser
Species Human (GRCh38)
Location X:152536202-152536224
Sequence AGGACTGAAGACAGCTAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199932328_1199932333 15 Left 1199932328 X:152536164-152536186 CCTGATGGGAAATAGTTGAAGAG No data
Right 1199932333 X:152536202-152536224 AGGACTGAAGACAGCTAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199932333 Original CRISPR AGGACTGAAGACAGCTAGTA CGG Intergenic
No off target data available for this crispr