ID: 1199936456

View in Genome Browser
Species Human (GRCh38)
Location X:152578966-152578988
Sequence ACTTCTGGAGAGCAGGATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199936456_1199936462 21 Left 1199936456 X:152578966-152578988 CCCCAATCCTGCTCTCCAGAAGT No data
Right 1199936462 X:152579010-152579032 TGATTCTGATTTTTATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199936456 Original CRISPR ACTTCTGGAGAGCAGGATTG GGG (reversed) Intergenic
No off target data available for this crispr