ID: 1199937830 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:152594008-152594030 |
| Sequence | CTGAATCTACAGATCAATCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199937827_1199937830 | 22 | Left | 1199937827 | X:152593963-152593985 | CCATGTCTACAAAAAATGCCTGC | No data | ||
| Right | 1199937830 | X:152594008-152594030 | CTGAATCTACAGATCAATCTGGG | No data | ||||
| 1199937828_1199937830 | 4 | Left | 1199937828 | X:152593981-152594003 | CCTGCTAGAACTTTGATTGAGAT | No data | ||
| Right | 1199937830 | X:152594008-152594030 | CTGAATCTACAGATCAATCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199937830 | Original CRISPR | CTGAATCTACAGATCAATCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||