ID: 1199937830

View in Genome Browser
Species Human (GRCh38)
Location X:152594008-152594030
Sequence CTGAATCTACAGATCAATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199937827_1199937830 22 Left 1199937827 X:152593963-152593985 CCATGTCTACAAAAAATGCCTGC No data
Right 1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG No data
1199937828_1199937830 4 Left 1199937828 X:152593981-152594003 CCTGCTAGAACTTTGATTGAGAT No data
Right 1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199937830 Original CRISPR CTGAATCTACAGATCAATCT GGG Intergenic
No off target data available for this crispr