ID: 1199947322

View in Genome Browser
Species Human (GRCh38)
Location X:152679849-152679871
Sequence CCTCTATCTTGGGTTGCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947322_1199947330 17 Left 1199947322 X:152679849-152679871 CCCGTTGCAACCCAAGATAGAGG No data
Right 1199947330 X:152679889-152679911 ACCACCCCTGCTGCCAACCCAGG No data
1199947322_1199947335 26 Left 1199947322 X:152679849-152679871 CCCGTTGCAACCCAAGATAGAGG No data
Right 1199947335 X:152679898-152679920 GCTGCCAACCCAGGACCACCCGG No data
1199947322_1199947337 28 Left 1199947322 X:152679849-152679871 CCCGTTGCAACCCAAGATAGAGG No data
Right 1199947337 X:152679900-152679922 TGCCAACCCAGGACCACCCGGGG No data
1199947322_1199947338 29 Left 1199947322 X:152679849-152679871 CCCGTTGCAACCCAAGATAGAGG No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947322_1199947336 27 Left 1199947322 X:152679849-152679871 CCCGTTGCAACCCAAGATAGAGG No data
Right 1199947336 X:152679899-152679921 CTGCCAACCCAGGACCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947322 Original CRISPR CCTCTATCTTGGGTTGCAAC GGG (reversed) Intergenic
No off target data available for this crispr