ID: 1199947326

View in Genome Browser
Species Human (GRCh38)
Location X:152679860-152679882
Sequence TTTTTTAGGGTCCTCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947326_1199947337 17 Left 1199947326 X:152679860-152679882 CCAAGATAGAGGACCCTAAAAAA No data
Right 1199947337 X:152679900-152679922 TGCCAACCCAGGACCACCCGGGG No data
1199947326_1199947335 15 Left 1199947326 X:152679860-152679882 CCAAGATAGAGGACCCTAAAAAA No data
Right 1199947335 X:152679898-152679920 GCTGCCAACCCAGGACCACCCGG No data
1199947326_1199947336 16 Left 1199947326 X:152679860-152679882 CCAAGATAGAGGACCCTAAAAAA No data
Right 1199947336 X:152679899-152679921 CTGCCAACCCAGGACCACCCGGG No data
1199947326_1199947330 6 Left 1199947326 X:152679860-152679882 CCAAGATAGAGGACCCTAAAAAA No data
Right 1199947330 X:152679889-152679911 ACCACCCCTGCTGCCAACCCAGG No data
1199947326_1199947338 18 Left 1199947326 X:152679860-152679882 CCAAGATAGAGGACCCTAAAAAA No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947326_1199947340 21 Left 1199947326 X:152679860-152679882 CCAAGATAGAGGACCCTAAAAAA No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947326 Original CRISPR TTTTTTAGGGTCCTCTATCT TGG (reversed) Intergenic