ID: 1199947327

View in Genome Browser
Species Human (GRCh38)
Location X:152679873-152679895
Sequence GGGTGGTGCTGGATTTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947327_1199947337 4 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947337 X:152679900-152679922 TGCCAACCCAGGACCACCCGGGG No data
1199947327_1199947336 3 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947336 X:152679899-152679921 CTGCCAACCCAGGACCACCCGGG No data
1199947327_1199947330 -7 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947330 X:152679889-152679911 ACCACCCCTGCTGCCAACCCAGG No data
1199947327_1199947335 2 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947335 X:152679898-152679920 GCTGCCAACCCAGGACCACCCGG No data
1199947327_1199947340 8 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data
1199947327_1199947347 22 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947327_1199947338 5 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947327_1199947344 18 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947327_1199947348 23 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947348 X:152679919-152679941 GGGGGCGGACTTCTCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947327 Original CRISPR GGGTGGTGCTGGATTTTTTA GGG (reversed) Intergenic
No off target data available for this crispr