ID: 1199947329

View in Genome Browser
Species Human (GRCh38)
Location X:152679884-152679906
Sequence GTTGGCAGCAGGGGTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947329_1199947344 7 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947329_1199947347 11 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947329_1199947336 -8 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947336 X:152679899-152679921 CTGCCAACCCAGGACCACCCGGG No data
1199947329_1199947340 -3 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data
1199947329_1199947338 -6 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947329_1199947348 12 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947348 X:152679919-152679941 GGGGGCGGACTTCTCAGGCTGGG No data
1199947329_1199947335 -9 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947335 X:152679898-152679920 GCTGCCAACCCAGGACCACCCGG No data
1199947329_1199947337 -7 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947337 X:152679900-152679922 TGCCAACCCAGGACCACCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947329 Original CRISPR GTTGGCAGCAGGGGTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr