ID: 1199947331

View in Genome Browser
Species Human (GRCh38)
Location X:152679890-152679912
Sequence TCCTGGGTTGGCAGCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947331_1199947344 1 Left 1199947331 X:152679890-152679912 CCACCCCTGCTGCCAACCCAGGA No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947331_1199947348 6 Left 1199947331 X:152679890-152679912 CCACCCCTGCTGCCAACCCAGGA No data
Right 1199947348 X:152679919-152679941 GGGGGCGGACTTCTCAGGCTGGG No data
1199947331_1199947347 5 Left 1199947331 X:152679890-152679912 CCACCCCTGCTGCCAACCCAGGA No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947331_1199947340 -9 Left 1199947331 X:152679890-152679912 CCACCCCTGCTGCCAACCCAGGA No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947331 Original CRISPR TCCTGGGTTGGCAGCAGGGG TGG (reversed) Intergenic
No off target data available for this crispr