ID: 1199947338

View in Genome Browser
Species Human (GRCh38)
Location X:152679901-152679923
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947329_1199947338 -6 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947328_1199947338 4 Left 1199947328 X:152679874-152679896 CCTAAAAAATCCAGCACCACCCC No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947326_1199947338 18 Left 1199947326 X:152679860-152679882 CCAAGATAGAGGACCCTAAAAAA No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947321_1199947338 30 Left 1199947321 X:152679848-152679870 CCCCGTTGCAACCCAAGATAGAG No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947324_1199947338 28 Left 1199947324 X:152679850-152679872 CCGTTGCAACCCAAGATAGAGGA No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947325_1199947338 19 Left 1199947325 X:152679859-152679881 CCCAAGATAGAGGACCCTAAAAA No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947327_1199947338 5 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data
1199947322_1199947338 29 Left 1199947322 X:152679849-152679871 CCCGTTGCAACCCAAGATAGAGG No data
Right 1199947338 X:152679901-152679923 GCCAACCCAGGACCACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947338 Original CRISPR GCCAACCCAGGACCACCCGG GGG Intergenic
No off target data available for this crispr