ID: 1199947340

View in Genome Browser
Species Human (GRCh38)
Location X:152679904-152679926
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947329_1199947340 -3 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data
1199947331_1199947340 -9 Left 1199947331 X:152679890-152679912 CCACCCCTGCTGCCAACCCAGGA No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data
1199947328_1199947340 7 Left 1199947328 X:152679874-152679896 CCTAAAAAATCCAGCACCACCCC No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data
1199947327_1199947340 8 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data
1199947326_1199947340 21 Left 1199947326 X:152679860-152679882 CCAAGATAGAGGACCCTAAAAAA No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data
1199947325_1199947340 22 Left 1199947325 X:152679859-152679881 CCCAAGATAGAGGACCCTAAAAA No data
Right 1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947340 Original CRISPR AACCCAGGACCACCCGGGGG CGG Intergenic