ID: 1199947344

View in Genome Browser
Species Human (GRCh38)
Location X:152679914-152679936
Sequence CACCCGGGGGCGGACTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947332_1199947344 -2 Left 1199947332 X:152679893-152679915 CCCCTGCTGCCAACCCAGGACCA No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947331_1199947344 1 Left 1199947331 X:152679890-152679912 CCACCCCTGCTGCCAACCCAGGA No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947328_1199947344 17 Left 1199947328 X:152679874-152679896 CCTAAAAAATCCAGCACCACCCC No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947327_1199947344 18 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947329_1199947344 7 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947333_1199947344 -3 Left 1199947333 X:152679894-152679916 CCCTGCTGCCAACCCAGGACCAC No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data
1199947334_1199947344 -4 Left 1199947334 X:152679895-152679917 CCTGCTGCCAACCCAGGACCACC No data
Right 1199947344 X:152679914-152679936 CACCCGGGGGCGGACTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947344 Original CRISPR CACCCGGGGGCGGACTTCTC AGG Intergenic
No off target data available for this crispr