ID: 1199947347

View in Genome Browser
Species Human (GRCh38)
Location X:152679918-152679940
Sequence CGGGGGCGGACTTCTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947333_1199947347 1 Left 1199947333 X:152679894-152679916 CCCTGCTGCCAACCCAGGACCAC No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947339_1199947347 -7 Left 1199947339 X:152679902-152679924 CCAACCCAGGACCACCCGGGGGC No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947331_1199947347 5 Left 1199947331 X:152679890-152679912 CCACCCCTGCTGCCAACCCAGGA No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947327_1199947347 22 Left 1199947327 X:152679873-152679895 CCCTAAAAAATCCAGCACCACCC No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947334_1199947347 0 Left 1199947334 X:152679895-152679917 CCTGCTGCCAACCCAGGACCACC No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947332_1199947347 2 Left 1199947332 X:152679893-152679915 CCCCTGCTGCCAACCCAGGACCA No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947328_1199947347 21 Left 1199947328 X:152679874-152679896 CCTAAAAAATCCAGCACCACCCC No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data
1199947329_1199947347 11 Left 1199947329 X:152679884-152679906 CCAGCACCACCCCTGCTGCCAAC No data
Right 1199947347 X:152679918-152679940 CGGGGGCGGACTTCTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947347 Original CRISPR CGGGGGCGGACTTCTCAGGC TGG Intergenic
No off target data available for this crispr