ID: 1199947800

View in Genome Browser
Species Human (GRCh38)
Location X:152681803-152681825
Sequence CCGCTGGACCAGAAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947791_1199947800 11 Left 1199947791 X:152681769-152681791 CCCAGGTGAGGAACCTGAGGGAG No data
Right 1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG No data
1199947784_1199947800 29 Left 1199947784 X:152681751-152681773 CCCAGGATCTGCTAAGACCCCAG No data
Right 1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG No data
1199947790_1199947800 12 Left 1199947790 X:152681768-152681790 CCCCAGGTGAGGAACCTGAGGGA No data
Right 1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG No data
1199947785_1199947800 28 Left 1199947785 X:152681752-152681774 CCAGGATCTGCTAAGACCCCAGG No data
Right 1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG No data
1199947792_1199947800 10 Left 1199947792 X:152681770-152681792 CCAGGTGAGGAACCTGAGGGAGG No data
Right 1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG No data
1199947796_1199947800 -2 Left 1199947796 X:152681782-152681804 CCTGAGGGAGGATTAAGGGTACC No data
Right 1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947800 Original CRISPR CCGCTGGACCAGAAGGCAGA TGG Intergenic
No off target data available for this crispr