ID: 1199947806

View in Genome Browser
Species Human (GRCh38)
Location X:152681844-152681866
Sequence CTGCGGAAACAGCAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199947806_1199947812 5 Left 1199947806 X:152681844-152681866 CCTTGCCCCTGCTGTTTCCGCAG No data
Right 1199947812 X:152681872-152681894 ATGGCCAGAGCTGTCAGTTGAGG No data
1199947806_1199947814 24 Left 1199947806 X:152681844-152681866 CCTTGCCCCTGCTGTTTCCGCAG No data
Right 1199947814 X:152681891-152681913 GAGGCCCCCTCTCTTATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199947806 Original CRISPR CTGCGGAAACAGCAGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr