ID: 1199952778

View in Genome Browser
Species Human (GRCh38)
Location X:152718654-152718676
Sequence TAGAATCCCCACTACTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199952778_1199952785 22 Left 1199952778 X:152718654-152718676 CCCTGGTAGTAGTGGGGATTCTA 0: 2
1: 0
2: 1
3: 4
4: 97
Right 1199952785 X:152718699-152718721 CCCATAGGGTCATAGAGTCTAGG 0: 2
1: 1
2: 3
3: 5
4: 64
1199952778_1199952783 8 Left 1199952778 X:152718654-152718676 CCCTGGTAGTAGTGGGGATTCTA 0: 2
1: 0
2: 1
3: 4
4: 97
Right 1199952783 X:152718685-152718707 CAGACTCACGTCTACCCATAGGG 0: 2
1: 2
2: 1
3: 9
4: 51
1199952778_1199952782 7 Left 1199952778 X:152718654-152718676 CCCTGGTAGTAGTGGGGATTCTA 0: 2
1: 0
2: 1
3: 4
4: 97
Right 1199952782 X:152718684-152718706 CCAGACTCACGTCTACCCATAGG 0: 2
1: 2
2: 0
3: 8
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199952778 Original CRISPR TAGAATCCCCACTACTACCA GGG (reversed) Intergenic
900718478 1:4160086-4160108 TATAATCCCCACTACTAGGGAGG + Intergenic
903298745 1:22363132-22363154 TAGAATACTCACTTCTTCCACGG + Intergenic
904072350 1:27811195-27811217 TATAATCCCCACTACTCTCGAGG + Intronic
907956066 1:59229528-59229550 TATCATCCCCATTGCTACCAGGG + Intergenic
908185489 1:61648917-61648939 TAGAAGCCCCAGAAGTACCATGG - Intergenic
908373636 1:63510066-63510088 TGTAATCCCAACTACTCCCAAGG + Exonic
913483712 1:119314945-119314967 TCGGCTCGCCACTACTACCAAGG - Intergenic
915518015 1:156424510-156424532 TAGAATCCCCATTTCTGTCAAGG + Intronic
917216348 1:172682178-172682200 TATAATCCCCACCACTGCAATGG - Intergenic
918453977 1:184688173-184688195 TATAATCCCAACTACTAGGATGG + Intergenic
921618325 1:217298019-217298041 TATAATCCCCACTAATGACATGG - Intergenic
924472082 1:244351390-244351412 TAGAATCTCCACCACCACCATGG - Intergenic
1073282087 10:102361966-102361988 TAACATCCTCACTACCACCAGGG - Intronic
1083714800 11:64569055-64569077 GAGGGTCCCCACTGCTACCAGGG - Intronic
1086537345 11:87863955-87863977 TACCACCCCCTCTACTACCAAGG + Intergenic
1087209334 11:95430674-95430696 TGTAGTCCCCACTACTACCAAGG - Intergenic
1087511759 11:99103334-99103356 TTGAATGCCCACTACCACCTTGG - Intronic
1089200470 11:116721746-116721768 CAGCATCCCCACTTTTACCAGGG - Intergenic
1090526156 11:127539725-127539747 TATAATCCCCATTAATTCCAGGG - Intergenic
1094304479 12:29002254-29002276 GAAAATGCCCACAACTACCAAGG + Intergenic
1095462105 12:42454340-42454362 TAAACTCCCGACTACTGCCATGG - Intronic
1096729018 12:53591231-53591253 AATAATCCCCACCAGTACCACGG + Intronic
1098246303 12:68522028-68522050 TAGAATCCTCACAACAACCCAGG - Intergenic
1099236815 12:80092481-80092503 TAGAAACCTCAGAACTACCATGG + Intergenic
1099438404 12:82670336-82670358 GAGAATCCCCACTAATCCCATGG - Intergenic
1101658803 12:106748053-106748075 TGTAATCCCCACAACAACCAGGG + Intronic
1101742533 12:107511873-107511895 TAGACTCCCCACTAAAACCTGGG - Intronic
1102645644 12:114401954-114401976 AGGAATGCCCACTACTGCCAGGG - Intronic
1105322037 13:19335203-19335225 CAGAATCTGCACTACTAACAAGG + Intergenic
1107899280 13:44995985-44996007 TGTAATCCCCAATACTAGCAGGG + Intronic
1109260902 13:60144113-60144135 TTGAATCCCCAGCCCTACCATGG + Intronic
1112266459 13:97928214-97928236 TAAAATCCCAGCTACTAGCAAGG + Intergenic
1116049843 14:39789396-39789418 TATTATCCCCACTGTTACCAAGG + Intergenic
1116877282 14:50124977-50124999 TAGAATTCCTACTTCTACGATGG + Intronic
1119344931 14:73915457-73915479 TATAATCCCCACTACTCGGAAGG - Intronic
1126757983 15:51942798-51942820 TATAATCCCAACTACTAGGAAGG + Intronic
1131352950 15:91718266-91718288 TACAATCTACACCACTACCAGGG + Intergenic
1139279175 16:65755092-65755114 TAAAATCCCCCCTACCCCCAAGG + Intergenic
1139295655 16:65898259-65898281 AAGAATCCCCGCTACTTCCCAGG + Intergenic
1141097573 16:81173806-81173828 TGTAATCCCCACTACAACCCTGG - Intergenic
1147377740 17:40032954-40032976 GAGAAACCCCACTTCTCCCAGGG + Intronic
1149826776 17:59835610-59835632 CAGAATCCCCACTACTAGTGAGG - Intronic
1157520807 18:48343925-48343947 TAGAAGCCCCACTCCTAGCCAGG - Intronic
1158705454 18:59788531-59788553 GAGCATCCCCACCACTGCCACGG + Intergenic
1162741017 19:12773798-12773820 TAGAATCCACACCCCCACCATGG + Intronic
1165635103 19:37334002-37334024 TCGGATCCCCACCACCACCAGGG + Intronic
931731371 2:65156237-65156259 TAGACTCCTCAGTTCTACCAAGG - Intergenic
933887477 2:86732564-86732586 TAAAATCCCTACTAATACCTTGG - Intronic
933922699 2:87064147-87064169 TAAAATCCCTACTAATACCTTGG + Intergenic
937720590 2:125090593-125090615 TGTAATCCCCACTACTACAGAGG + Intergenic
940562669 2:155320793-155320815 TAAAATGCCTATTACTACCACGG - Intergenic
941222454 2:162800337-162800359 TTAAATCCCCACTAATACCTGGG + Intronic
943458857 2:188143907-188143929 GAGAGTCCCCACTACTTTCATGG - Intergenic
944397710 2:199288319-199288341 TAAAATCCCCATAACTACAATGG + Intronic
944530483 2:200663113-200663135 TAGAATCCCCACAATTGCCTTGG + Intronic
944834886 2:203569604-203569626 TGTAATCCCAACTACTAGCAGGG - Intergenic
945399815 2:209367606-209367628 TGGAGTCACCACTGCTACCATGG - Intergenic
947877898 2:233480082-233480104 TCGAACCCCCACTTCTGCCATGG + Intronic
948105005 2:235406380-235406402 TCCACTCCCCACTACCACCAGGG + Intergenic
1172193733 20:33077929-33077951 TAGAGTCCCCACTGCCTCCAGGG + Intergenic
1180129683 21:45819619-45819641 TAGAATCTACACTACCATCAAGG - Intronic
1180699241 22:17772840-17772862 TAGAATCCCCCATACCACCCTGG + Intronic
1182056503 22:27359597-27359619 TAAAATTCCAACTCCTACCATGG - Intergenic
1183293919 22:37019122-37019144 TAGAATCCCCTTTCCTTCCAAGG + Exonic
951688754 3:25373696-25373718 TAAACTCCCCTCTACTACCATGG + Intronic
956784922 3:72634619-72634641 CAGAATCTCAACTAATACCACGG - Intergenic
959504048 3:107138468-107138490 TAGTTTCCCCATTTCTACCAAGG - Intergenic
965852629 3:173048377-173048399 TAGAATCCCCAGTGTTACCCAGG - Intronic
983111476 4:163755463-163755485 TTGAATCCCTAATAATACCAGGG + Intronic
995788794 5:115861060-115861082 TAGAATTCAGACTACTACAAAGG + Intronic
997794663 5:136796592-136796614 TGTAATCCCAACTACTAGCAGGG + Intergenic
1000025697 5:157357191-157357213 TAGAGTGCCCACTAATAGCAAGG - Intronic
1001694501 5:173660152-173660174 TAGAAAGCCAACCACTACCAAGG + Intergenic
1002019812 5:176356084-176356106 TAGAATCCCAACTACTCGCTAGG - Intronic
1011772836 6:90693972-90693994 TATAATCCCAGCTACTACTAGGG + Intergenic
1013314407 6:108927286-108927308 TAGAATCCTCACAACTGCTAGGG + Intronic
1020647474 7:10832328-10832350 TATAATCCCAGCTACTACCCAGG + Intergenic
1022601411 7:31763597-31763619 TAAAATCCTCACCACAACCATGG - Intronic
1022803318 7:33796485-33796507 TAGAAACACTACTACTATCATGG - Intergenic
1028425014 7:90676652-90676674 TATAATCCCAGCTACTCCCAAGG - Intronic
1030473583 7:109999358-109999380 CACAATGCCCACAACTACCATGG + Intergenic
1036754178 8:11461441-11461463 TCTAATCCCCACTGCCACCATGG - Intronic
1043582122 8:81726347-81726369 TATAATCCCTACTATTATCATGG + Intronic
1044823299 8:96173449-96173471 AAGAATCCCCAGAAATACCAAGG - Intergenic
1049523715 8:143109428-143109450 TAGTTTCCCCATTTCTACCAAGG + Intergenic
1053489756 9:38489463-38489485 CAAAATTCCCACCACTACCAAGG - Intergenic
1054848979 9:69826936-69826958 CAAAATCCCCACTAAAACCAGGG + Intronic
1055015144 9:71608523-71608545 TATAATCCCCACTACTCAGAAGG + Intergenic
1057084778 9:92199184-92199206 TGTAATCCCCACTACTCACAAGG + Intergenic
1057670090 9:97078772-97078794 CAAAATTCCCACCACTACCAAGG - Intergenic
1060377889 9:123134215-123134237 AAGATTCCCCACTATAACCAAGG + Intronic
1060595956 9:124849070-124849092 TAGAATCTACATTACCACCAGGG + Intergenic
1061242908 9:129384566-129384588 TATAATCCCCACAACTGCCCTGG - Intergenic
1187266846 X:17741476-17741498 TAAAATCCAAACTCCTACCATGG - Intronic
1190469432 X:50763511-50763533 TAGCTTTCCCACCACTACCATGG + Intronic
1190508256 X:51150537-51150559 TATAATCCCAACTACTACTCGGG - Intergenic
1190575535 X:51832827-51832849 GAGAATCAGCAGTACTACCAGGG + Intronic
1190729133 X:53213300-53213322 TAGAATCTCCACCACTACCAAGG + Intronic
1195678209 X:107523489-107523511 TACAATCCCCACTTCCTCCATGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198462920 X:136880531-136880553 TATAATCCCCAGTCCTAACACGG + Intronic
1199952778 X:152718654-152718676 TAGAATCCCCACTACTACCAGGG - Intergenic
1199956905 X:152749794-152749816 TAGAATCCCCACTACTACCAGGG + Intergenic
1201541582 Y:15110690-15110712 TGGAATCCTCACTGCTAGCACGG - Intergenic