ID: 1199956905

View in Genome Browser
Species Human (GRCh38)
Location X:152749794-152749816
Sequence TAGAATCCCCACTACTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199956900_1199956905 8 Left 1199956900 X:152749763-152749785 CCCTATGGGTAGACGTGAGTCTG No data
Right 1199956905 X:152749794-152749816 TAGAATCCCCACTACTACCAGGG No data
1199956898_1199956905 22 Left 1199956898 X:152749749-152749771 CCTAGACTCTATGACCCTATGGG No data
Right 1199956905 X:152749794-152749816 TAGAATCCCCACTACTACCAGGG No data
1199956901_1199956905 7 Left 1199956901 X:152749764-152749786 CCTATGGGTAGACGTGAGTCTGG No data
Right 1199956905 X:152749794-152749816 TAGAATCCCCACTACTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199956905 Original CRISPR TAGAATCCCCACTACTACCA GGG Intergenic
No off target data available for this crispr