ID: 1199959652

View in Genome Browser
Species Human (GRCh38)
Location X:152768828-152768850
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 2, 1: 0, 2: 2, 3: 24, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199959652_1199959657 6 Left 1199959652 X:152768828-152768850 CCCTCAACTCTCTGGTCACCCTG 0: 2
1: 0
2: 2
3: 24
4: 266
Right 1199959657 X:152768857-152768879 CAATGAGCACAGAGCACATTTGG 0: 2
1: 0
2: 2
3: 24
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199959652 Original CRISPR CAGGGTGACCAGAGAGTTGA GGG (reversed) Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900284450 1:1892246-1892268 CAGGGTGTGGAGAGAGTAGAAGG - Intergenic
900940454 1:5795321-5795343 CAGGCTGACCAGATATTTGCGGG - Intergenic
902272928 1:15317524-15317546 CAGGGTTTCAAGTGAGTTGATGG + Intronic
902976868 1:20094916-20094938 AAGGGTGACCAAGTAGTTGATGG + Intergenic
905517571 1:38573307-38573329 CAAAGTGACCATACAGTTGATGG - Intergenic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
905883984 1:41481976-41481998 CAGGGTGGCCCCAGAGTTGCTGG - Intronic
906045647 1:42828943-42828965 CAGAGTCACTAGAAAGTTGAGGG + Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG + Intronic
914814165 1:151051180-151051202 CACGGTGACCAGAGATTTCTAGG + Exonic
914844856 1:151277213-151277235 CATGATGAGGAGAGAGTTGATGG - Intergenic
915041860 1:152974546-152974568 CAGAGAGACCAGAGAATTTATGG + Intergenic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
917435964 1:175021675-175021697 GAGAGGGGCCAGAGAGTTGATGG - Intronic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
920372298 1:205486792-205486814 AAGGGAGGACAGAGAGTTGAGGG - Intergenic
920743192 1:208600638-208600660 CAGGGTGACCAGTGCTCTGATGG + Intergenic
921508693 1:216005997-216006019 CAGTGTGACCGGAGATGTGATGG - Intronic
923109566 1:230879925-230879947 CAGGGTGACTGGAGAGATGGAGG - Intergenic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
1063315265 10:4998302-4998324 AAAGATGACCAGAGAGTGGACGG - Intronic
1064451308 10:15444641-15444663 CAGGGAGATCACAGAGCTGAAGG + Intergenic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1067219878 10:44336407-44336429 CAGAGGAACCAGTGAGTTGAAGG + Intergenic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1070425866 10:76286505-76286527 CTGAGTGACCAGAGAGGGGATGG + Intronic
1070430040 10:76328520-76328542 CAGGGGGACCTGAGAATTAAGGG - Intronic
1070780625 10:79135642-79135664 CTGGGTGGCCAGAGAGCTAAGGG + Intronic
1071961378 10:90811403-90811425 CAGGTGGATCAGAGAGATGAAGG - Intronic
1076495870 10:130897594-130897616 CAGGTGGAACAGAGAGCTGAAGG - Intergenic
1076931989 10:133537429-133537451 CCTGGTGACCAGAGAGGTGGAGG + Intronic
1076947449 10:133660832-133660854 AATGGTGACCTGAGAGTTGAGGG - Intergenic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1079251424 11:18790801-18790823 CAAGGTCACCAGAGAGTTAGTGG - Intronic
1082916010 11:58438213-58438235 CAAGGTTACCACAGAGCTGATGG - Intergenic
1083299891 11:61734820-61734842 TGGGGTGACAAGAGAGTTCAGGG - Intronic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084255852 11:67942152-67942174 CACGGTGACCACAGTCTTGAAGG + Intergenic
1084816909 11:71653175-71653197 CACGGTGACCACAGTCTTGAAGG - Intergenic
1085065077 11:73487886-73487908 CAGGGTTAGGAGAGAGGTGAGGG - Intronic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1088977679 11:114830313-114830335 CAGGGTGTCAAGAGAGCTGTGGG + Intergenic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1089980964 11:122772219-122772241 CAGGGTGTCAAGAGAGCTCACGG - Intronic
1090240690 11:125179491-125179513 CAGGGGGAGCATAGAGTTGAAGG + Intronic
1090415464 11:126537261-126537283 CAGAATGTCCTGAGAGTTGAGGG - Intronic
1090531925 11:127600091-127600113 CAGTGTGACCAGCTTGTTGAAGG + Intergenic
1091996826 12:5000464-5000486 CATCGTTACCAGAGAGGTGAGGG - Intergenic
1092426090 12:8376892-8376914 CACGGTGACCACAGTCTTGAAGG + Intergenic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1096797143 12:54085061-54085083 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1097072394 12:56364674-56364696 CAAGGAAACCAGAAAGTTGATGG + Intergenic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1099943266 12:89215711-89215733 CAGCATGAACAGAGAGTTGACGG + Intergenic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102997196 12:117360234-117360256 CACTGTGACCAGAGAGCTCATGG - Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1106518956 13:30480024-30480046 CAGTGTGACCAGAATCTTGAAGG - Intronic
1109213650 13:59563465-59563487 GAGGGTGACCAGAGGAGTGAGGG - Intergenic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1117330547 14:54707702-54707724 GGGTGTGAGCAGAGAGTTGAAGG + Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119081085 14:71694343-71694365 CAGTGAAAACAGAGAGTTGAAGG - Intronic
1121309351 14:92926844-92926866 CAAGGTGTACAGACAGTTGAAGG + Intronic
1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG + Intergenic
1123069970 14:105637847-105637869 CAGCGTGTCCTGAGAGTTAAAGG + Intergenic
1123074560 14:105661515-105661537 CAGCGTGTCCTGAGAGTTAAAGG + Intergenic
1123089207 14:105734634-105734656 CAGCGTGTCCTGAGAGTTAAAGG + Intergenic
1123094993 14:105762791-105762813 CAGCGTGTCCTGAGAGTTAAAGG + Intergenic
1124367685 15:29085144-29085166 CAGGGTAACCAAATACTTGAGGG - Intronic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125767256 15:42144047-42144069 CAGTGGGAACGGAGAGTTGATGG + Exonic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126838350 15:52691057-52691079 CAGGGGGAGTGGAGAGTTGAGGG + Intronic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1127394674 15:58534997-58535019 GAGGATGACATGAGAGTTGAAGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1130144528 15:81263785-81263807 AAGGGTGACCTGTGACTTGAAGG - Intronic
1132880746 16:2160741-2160763 CAGAGAGGCCAGAGAATTGAAGG + Intronic
1134112773 16:11525539-11525561 CCGAGTGATCAAAGAGTTGAAGG - Intergenic
1134202510 16:12210618-12210640 CAGGGGGACCAGAAAGGTGGTGG - Intronic
1135044046 16:19140183-19140205 CAGGATGATCAGAGAGCTGGGGG - Intronic
1136241530 16:28947589-28947611 CAGGGTGCCGAGCGAGGTGATGG + Intergenic
1136611666 16:31370286-31370308 CAGGGTGCACAGAGATTTAAAGG + Intronic
1137759688 16:50930320-50930342 CACTGTGACCAGAGGCTTGAAGG + Intergenic
1138564176 16:57820579-57820601 CAGAGTGATCTTAGAGTTGATGG + Intronic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1140739470 16:77928233-77928255 CCTGGTGACCAGAGAGATGTTGG - Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG + Intronic
1141244528 16:82293564-82293586 CAGGGGGATCATAGGGTTGAAGG + Intergenic
1143048807 17:4105103-4105125 TGGCTTGACCAGAGAGTTGAGGG + Intronic
1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG + Intronic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1145941386 17:28744981-28745003 CAGGGCGCCCAGAAACTTGATGG - Intronic
1147555173 17:41474160-41474182 AAGGATGACCAGATACTTGAAGG + Intergenic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147868020 17:43566581-43566603 CAGGTTTACCAGGGAGTTCACGG + Intronic
1151133772 17:71925165-71925187 CAGGGTGCCCAGATCGCTGAAGG + Intergenic
1151179163 17:72313247-72313269 CAGGTGGATCAGAGAGTTGCTGG - Intergenic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152828695 17:82483965-82483987 CAGGGCTGCCAGGGAGTTGAAGG + Intronic
1152887502 17:82860938-82860960 CAGGGTGGCCAGGGACTTGGCGG + Intronic
1203171347 17_GL000205v2_random:149830-149852 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155822829 18:30399550-30399572 CAGGGTGCCCAGATATTTTAAGG + Intergenic
1156194916 18:34763735-34763757 CAGGGTGACTAGAATGTTTAAGG + Intronic
1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG + Intergenic
1157091814 18:44645090-44645112 CAGGGAGAGCTGAGACTTGATGG + Intergenic
1158756020 18:60326554-60326576 AAGGATGACAAGAGACTTGACGG - Intergenic
1159456782 18:68669366-68669388 CAGGGGGACCAGCGAGTGCAAGG + Intergenic
1160144449 18:76352151-76352173 CAGGATGTCCAGAGAGCTGGGGG + Intergenic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1163518044 19:17776595-17776617 CAGGGTGACAAGAAGGCTGAAGG + Intronic
1167690523 19:50981890-50981912 CAGGGTGACAAGATTATTGATGG - Exonic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926660019 2:15454733-15454755 GAGGGTGATCAGAAATTTGATGG - Intronic
926870919 2:17416052-17416074 CAGGGTAACCAAAGAGTTACAGG + Intergenic
928878314 2:36067191-36067213 CAGGTTGACCAGAAAGGTAAAGG + Intergenic
929174018 2:38959509-38959531 AAGGGAGAGAAGAGAGTTGAAGG + Intronic
930621566 2:53649521-53649543 CTGGTTGAGCAGAGAATTGAGGG - Intronic
932296108 2:70624610-70624632 CAGGTGGATCAGAGAGATGAAGG - Intronic
932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG + Intergenic
933651309 2:84852450-84852472 CAGAATGACCGCAGAGTTGAGGG + Intronic
938804404 2:134792726-134792748 CATGATGAACACAGAGTTGATGG + Intergenic
941501637 2:166285769-166285791 CAGGGAGGCCTGAGAGATGAAGG + Intronic
944376459 2:199049809-199049831 CAGGGATACCAGAGACTTGTGGG + Intergenic
945067862 2:205962191-205962213 CAGGGTGGCCAGTCAGTGGATGG - Intergenic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
1168810874 20:703788-703810 CAGTGTGAACAGGAAGTTGACGG + Intergenic
1168912317 20:1458785-1458807 CACAGAGACCAGAGAGTTGAAGG + Intronic
1171848995 20:30294918-30294940 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1172224836 20:33298467-33298489 AAGGGCGACCAGAGAGGAGAAGG + Intronic
1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG + Intergenic
1174477339 20:50805333-50805355 CAGATTGGCCAGAGACTTGAAGG + Intronic
1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG + Intronic
1175040490 20:56045417-56045439 GAGGGACACCAAAGAGTTGATGG + Intergenic
1175570242 20:60012615-60012637 CAAGCTGGCCAGAGAGCTGAGGG - Exonic
1176327331 21:5511658-5511680 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176330378 21:5544573-5544595 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176397379 21:6276378-6276400 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176400426 21:6309293-6309315 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176436731 21:6679811-6679833 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176439778 21:6712726-6712748 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176460993 21:7006881-7006903 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176464040 21:7039795-7039817 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176484554 21:7388659-7388681 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176487601 21:7421574-7421596 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1182265648 22:29112997-29113019 CGTGGTGAACAGAGTGTTGAGGG + Intronic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
1183742682 22:39677555-39677577 CTGGGAGACCAGACAGCTGAGGG - Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184498514 22:44857934-44857956 CAGAGGGACCACAGAGCTGAGGG + Intronic
950750687 3:15125620-15125642 CACGGTGACCACAGTCTTGAAGG - Intergenic
953375620 3:42426074-42426096 CAGGGTAACTAAAAAGTTGAGGG + Intergenic
957070765 3:75566193-75566215 CATGGTGACCACAGTCTTGAAGG + Intergenic
957217053 3:77334205-77334227 CAGGGTGGCCAGAGATTTTGAGG + Intronic
959439283 3:106357280-106357302 CAGGGACACCAGTGAGTTGTAGG + Intergenic
961283331 3:125780375-125780397 CACGGTGACCACAGTCTTGAAGG - Intergenic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
963485188 3:145927009-145927031 AAGGGAGACCTGAGAGTAGATGG + Intergenic
965134263 3:164741421-164741443 TAGGGTTACAAGAGAGGTGAGGG - Intergenic
965868631 3:173238261-173238283 CAGGGAGATTAGAGAGTGGAGGG - Intergenic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967410288 3:189160229-189160251 CAGGTTGACTAGAGATTTGATGG + Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
969341887 4:6547419-6547441 CAGGGTGACCAGTGAGGTCGAGG - Intronic
969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG + Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969739592 4:9014563-9014585 CATGGTGACCACAGTCTTGAAGG - Intergenic
969798765 4:9546096-9546118 CATGGTGACCACAGTCTTGAAGG - Intergenic
970174935 4:13330223-13330245 CAGGGTGACCAGCCAGTTGCGGG + Intergenic
972337421 4:38119847-38119869 CAGGCTGACCACAGACTGGAGGG + Intronic
975317269 4:72968854-72968876 CAAAGTGACTAGATAGTTGAAGG + Intergenic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
976221061 4:82757170-82757192 CAGGGTAACCAGAGAGTGACGGG - Intronic
977182722 4:93897519-93897541 CAGTGTGACTAAAAAGTTGAAGG + Intergenic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
981245509 4:142532388-142532410 CAGAACGACCAGAGACTTGAAGG - Intronic
981462150 4:145025888-145025910 CAGTGTGAGCAGGCAGTTGATGG + Intronic
982639409 4:157938462-157938484 AAGGGAGACTAAAGAGTTGACGG + Intergenic
983406403 4:167336260-167336282 AAGGGAGACCAGTGAGTAGAAGG - Intergenic
985450904 4:190061632-190061654 AATGGTGACCTGAGAGTTGAGGG - Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
991350514 5:65716078-65716100 CAGGTTTAACAGAGAGTTCAGGG + Intronic
991413846 5:66371166-66371188 GAGGCTGACCAGAGAGGTAATGG - Intergenic
992118300 5:73564325-73564347 CAGGGTGCTCAGAGAGCTTAGGG - Intronic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
997587015 5:135049220-135049242 CAGGCCCACCAGAGAGTGGAAGG - Intronic
998231905 5:140366243-140366265 CATGGTACCCAGAGAGTTCAAGG + Exonic
999929603 5:156416681-156416703 AAAGGAGACCAGAGAGATGAAGG - Intronic
1001287950 5:170437464-170437486 GGGGGTGAGCAGAGATTTGAAGG - Intronic
1001632013 5:173182461-173182483 TAGGAAGACCAGAGATTTGATGG - Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1003896070 6:10608945-10608967 CAGGGTGGCCAGAGAGCTCCTGG + Intronic
1006175891 6:32121287-32121309 CAGGGAGGCCTCAGAGTTGACGG + Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008547477 6:52595993-52596015 CAGCCTGAACAGAGAGTTGGGGG - Intergenic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1011001151 6:82589864-82589886 CTGGGTCACCGGGGAGTTGAGGG + Intergenic
1014513232 6:122350602-122350624 AAGGTAGACCAGAGAGTTTAAGG - Intergenic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1020227313 7:6290475-6290497 CAGGATGTCCACAGACTTGAAGG + Intergenic
1021662711 7:22936259-22936281 GAGGGTGACCAGATAGTTAGTGG - Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1024220835 7:47285172-47285194 CAGGGTGACTTGTGAGTTGCTGG + Intronic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1027971334 7:85085627-85085649 CAGAGTGACAAGAGAGTACACGG + Intronic
1028640908 7:93040598-93040620 AAGGGTGAGCAGAGCGGTGAGGG - Intergenic
1029073044 7:97915495-97915517 CACGGTGACCACAGTCTTGAAGG + Intergenic
1029245494 7:99196667-99196689 CAGGGTTACCATGGAGCTGAGGG - Intronic
1029306022 7:99620608-99620630 CAGGGTGACGAGAGTGTGCACGG - Intronic
1031857546 7:126940571-126940593 CATGGTGACAACAAAGTTGATGG - Intronic
1033300150 7:140177654-140177676 CAAGGAGACCAGAGCGTCGATGG + Intergenic
1034359626 7:150482928-150482950 CAAGGTTACCACAGAGTTGGGGG - Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036244634 8:7105773-7105795 CATGGTGACCACAGTCTTGAAGG - Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036897195 8:12645659-12645681 CATGGTGACCACAGTCTTGAAGG + Intergenic
1037946621 8:22993577-22993599 AAGGGAGACCAGAGAGATTAAGG + Intronic
1038021610 8:23555846-23555868 CAGGGTGACCTGAACGCTGAAGG + Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1043448337 8:80341023-80341045 CAGAGTAACCAGAGATGTGAAGG + Intergenic
1045321169 8:101082347-101082369 CAGGGTGATCAGATAGATAATGG - Intergenic
1047517844 8:125570374-125570396 CAGGATGACCAGACAATAGAAGG + Intergenic
1049513692 8:143042715-143042737 CAGGTAGCCCAGAGAGCTGAGGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1051047751 9:12895506-12895528 CATGGAGACAAGAGAGTAGAAGG + Intergenic
1051233871 9:14978588-14978610 CAGGCTGGCCTGAGAGTTAAGGG - Intergenic
1052748390 9:32464028-32464050 CAGAGTGACCAGAGAATTCTGGG + Intronic
1053543928 9:39003306-39003328 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1053808359 9:41826803-41826825 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1054450400 9:65400859-65400881 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1054622233 9:67360625-67360647 CACTGTGCCCAGGGAGTTGATGG + Intergenic
1054981837 9:71215823-71215845 CAGGATGAACAGACAGTTCAGGG + Intronic
1055527682 9:77151764-77151786 CAGTTTGACCAAAGATTTGAAGG + Intergenic
1057577313 9:96253575-96253597 TGGAGTGACCAGAGAGTGGATGG - Intronic
1057698693 9:97347364-97347386 CACGGTGACCCGGGTGTTGAGGG - Exonic
1058380238 9:104369928-104369950 CATGTTGCCCAGAGACTTGATGG + Intergenic
1059432818 9:114260155-114260177 AAGGGAGCCCAGTGAGTTGAAGG - Intronic
1060118945 9:120969788-120969810 CAGGGTGATAAGAGAATTCAAGG + Intronic
1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG + Intronic
1061130939 9:128707323-128707345 CAGAGTGACCCGAGAGTTGCGGG + Exonic
1061299858 9:129698157-129698179 GAGGGGGCCCAGAGAGCTGAAGG - Intronic
1062084954 9:134643634-134643656 CAGGGTCAGGAGAGAGTTGGTGG - Intronic
1203431717 Un_GL000195v1:95753-95775 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1186990323 X:15060142-15060164 CAGGCTGAGCAGATAGATGAGGG + Intergenic
1187821296 X:23290946-23290968 CAGGTTGAGCAGAGAGTTCTAGG - Intergenic
1189206536 X:39244341-39244363 CAGTATTATCAGAGAGTTGATGG - Intergenic
1192151434 X:68715124-68715146 GAGGGTGCCCAGGGAGTTCAGGG - Intronic
1197512688 X:127390253-127390275 CAGGGTGACCACAGAGGTCCTGG + Intergenic
1198236295 X:134738598-134738620 CCGGGTGACCAGACAGCTCATGG + Intronic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic