ID: 1199961879

View in Genome Browser
Species Human (GRCh38)
Location X:152786651-152786673
Sequence CCGCTGGACCAGAAGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199961879_1199961883 -2 Left 1199961879 X:152786651-152786673 CCATCTGCCTTCTGGTCCAGCGG No data
Right 1199961883 X:152786672-152786694 GGTACCCTTAATCCTCCCTCAGG No data
1199961879_1199961888 11 Left 1199961879 X:152786651-152786673 CCATCTGCCTTCTGGTCCAGCGG No data
Right 1199961888 X:152786685-152786707 CTCCCTCAGGTTCCTCACCTGGG No data
1199961879_1199961887 10 Left 1199961879 X:152786651-152786673 CCATCTGCCTTCTGGTCCAGCGG No data
Right 1199961887 X:152786684-152786706 CCTCCCTCAGGTTCCTCACCTGG No data
1199961879_1199961895 29 Left 1199961879 X:152786651-152786673 CCATCTGCCTTCTGGTCCAGCGG No data
Right 1199961895 X:152786703-152786725 CTGGGGTCTTAGCAGATCCTGGG No data
1199961879_1199961894 28 Left 1199961879 X:152786651-152786673 CCATCTGCCTTCTGGTCCAGCGG No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data
1199961879_1199961889 12 Left 1199961879 X:152786651-152786673 CCATCTGCCTTCTGGTCCAGCGG No data
Right 1199961889 X:152786686-152786708 TCCCTCAGGTTCCTCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199961879 Original CRISPR CCGCTGGACCAGAAGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr