ID: 1199961889

View in Genome Browser
Species Human (GRCh38)
Location X:152786686-152786708
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199961879_1199961889 12 Left 1199961879 X:152786651-152786673 CCATCTGCCTTCTGGTCCAGCGG No data
Right 1199961889 X:152786686-152786708 TCCCTCAGGTTCCTCACCTGGGG No data
1199961882_1199961889 -4 Left 1199961882 X:152786667-152786689 CCAGCGGTACCCTTAATCCTCCC No data
Right 1199961889 X:152786686-152786708 TCCCTCAGGTTCCTCACCTGGGG No data
1199961878_1199961889 15 Left 1199961878 X:152786648-152786670 CCTCCATCTGCCTTCTGGTCCAG No data
Right 1199961889 X:152786686-152786708 TCCCTCAGGTTCCTCACCTGGGG No data
1199961881_1199961889 5 Left 1199961881 X:152786658-152786680 CCTTCTGGTCCAGCGGTACCCTT No data
Right 1199961889 X:152786686-152786708 TCCCTCAGGTTCCTCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199961889 Original CRISPR TCCCTCAGGTTCCTCACCTG GGG Intergenic
No off target data available for this crispr