ID: 1199961894

View in Genome Browser
Species Human (GRCh38)
Location X:152786702-152786724
Sequence CCTGGGGTCTTAGCAGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199961891_1199961894 -9 Left 1199961891 X:152786688-152786710 CCTCAGGTTCCTCACCTGGGGTC No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data
1199961886_1199961894 -5 Left 1199961886 X:152786684-152786706 CCTCCCTCAGGTTCCTCACCTGG No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data
1199961882_1199961894 12 Left 1199961882 X:152786667-152786689 CCAGCGGTACCCTTAATCCTCCC No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data
1199961881_1199961894 21 Left 1199961881 X:152786658-152786680 CCTTCTGGTCCAGCGGTACCCTT No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data
1199961885_1199961894 2 Left 1199961885 X:152786677-152786699 CCTTAATCCTCCCTCAGGTTCCT No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data
1199961879_1199961894 28 Left 1199961879 X:152786651-152786673 CCATCTGCCTTCTGGTCCAGCGG No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data
1199961884_1199961894 3 Left 1199961884 X:152786676-152786698 CCCTTAATCCTCCCTCAGGTTCC No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data
1199961890_1199961894 -8 Left 1199961890 X:152786687-152786709 CCCTCAGGTTCCTCACCTGGGGT No data
Right 1199961894 X:152786702-152786724 CCTGGGGTCTTAGCAGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199961894 Original CRISPR CCTGGGGTCTTAGCAGATCC TGG Intergenic
No off target data available for this crispr