ID: 1199962345

View in Genome Browser
Species Human (GRCh38)
Location X:152788556-152788578
Sequence GCTGCCAACCCAGGACCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199962345_1199962358 26 Left 1199962345 X:152788556-152788578 CCGGGTGGTCCTGGGTTGGCAGC No data
Right 1199962358 X:152788605-152788627 CCTCTATCTTGGGTTGCAACGGG No data
1199962345_1199962355 16 Left 1199962345 X:152788556-152788578 CCGGGTGGTCCTGGGTTGGCAGC No data
Right 1199962355 X:152788595-152788617 TTTTTAGGGTCCTCTATCTTGGG No data
1199962345_1199962351 -9 Left 1199962345 X:152788556-152788578 CCGGGTGGTCCTGGGTTGGCAGC No data
Right 1199962351 X:152788570-152788592 GTTGGCAGCAGGGGTGGTGCTGG No data
1199962345_1199962352 1 Left 1199962345 X:152788556-152788578 CCGGGTGGTCCTGGGTTGGCAGC No data
Right 1199962352 X:152788580-152788602 GGGGTGGTGCTGGATTTTTTAGG No data
1199962345_1199962359 27 Left 1199962345 X:152788556-152788578 CCGGGTGGTCCTGGGTTGGCAGC No data
Right 1199962359 X:152788606-152788628 CTCTATCTTGGGTTGCAACGGGG No data
1199962345_1199962356 25 Left 1199962345 X:152788556-152788578 CCGGGTGGTCCTGGGTTGGCAGC No data
Right 1199962356 X:152788604-152788626 TCCTCTATCTTGGGTTGCAACGG No data
1199962345_1199962353 2 Left 1199962345 X:152788556-152788578 CCGGGTGGTCCTGGGTTGGCAGC No data
Right 1199962353 X:152788581-152788603 GGGTGGTGCTGGATTTTTTAGGG No data
1199962345_1199962354 15 Left 1199962345 X:152788556-152788578 CCGGGTGGTCCTGGGTTGGCAGC No data
Right 1199962354 X:152788594-152788616 TTTTTTAGGGTCCTCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199962345 Original CRISPR GCTGCCAACCCAGGACCACC CGG (reversed) Intergenic
No off target data available for this crispr