ID: 1199962820

View in Genome Browser
Species Human (GRCh38)
Location X:152791773-152791795
Sequence AGAGAGAGGGCAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199962812_1199962820 25 Left 1199962812 X:152791725-152791747 CCCAGTAGTTGCTGTGTGGCACG No data
Right 1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG No data
1199962813_1199962820 24 Left 1199962813 X:152791726-152791748 CCAGTAGTTGCTGTGTGGCACGG No data
Right 1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199962820 Original CRISPR AGAGAGAGGGCAGTGATTGT GGG Intergenic
No off target data available for this crispr